Báo cáo khoa học: Temporal expression of heat shock genes during cold stress and recovery from chill coma in adult Drosophila melanogaster - Pdf 11

Temporal expression of heat shock genes during cold
stress and recovery from chill coma in adult
Drosophila melanogaster
Herve
´
Colinet
1,2
, Siu Fai Lee
2
and Ary Hoffmann
2
1 Unite
´
d’E
´
cologie et de Bioge
´
ographie, Biodiversity Research Centre, Universite
´
catholique de Louvain, Louvain-la-Neuve, Belgium
2 Department of Genetics, Centre for Environmental Stress and Adaptation Research, Bio21 Institute, University of Melbourne, Parkville,
Australia
Introduction
Temperature plays a crucial role in determining the
distribution and abundance of animals. In insects and
other ectotherms, temperature simultaneously affects
physiological processes, biophysical structures, and
metabolic activities, as well as developmental rates and
growth [1]. Many insect species are seasonally exposed
to suboptimal or supraoptimal temperatures, and this
has led to the evolution of protective biochemical and

is the increase in expression of heat shock proteins (Hsps). In insects, this
process has been widely examined for heat stress, but the response to cold
stress has been far less studied. In the present study, we focused on 11 Dro-
sophila melanogaster Hsp genes during the stress exposure and recovery
phases. The temporal gene expression of adults was analyzed during 9 h of
cold stress at 0 °C and during 8 h of recovery at 25 °C. Increased expres-
sion of some, but not all, Hsp genes was elicited in response to cold stress.
The transcriptional activity of Hsp genes was not modulated during the
cold stress, and peaks of expression occurred during the recovery phase.
On the basis of their response, we consider that Hsp60, Hsp67Ba and
Hsc70-1 are not cold-inducible, whereas Hsp22, Hsp23, Hsp26, Hsp27,
Hsp40, Hsp68, Hsp70Aa and Hsp83 are induced by cold. This study sug-
gests the importance of the recovery phase for repairing chilling injuries,
and highlights the need to further investigate the contributions of specific
Hsp genes to thermal stress responses. Parallels are drawn between the
stress response networks resulting from heat and cold stress.
Abbreviations
C
p
, crossing point; C
t
, cycle threshold; HSF, heat shock factor; Hsp, heat shock protein; qRT-PCR, quantitative RT-PCR; RA, recovery with
agar; RF, recovery with food; RNAi, RNA interference; sHsp, small heat shock protein.
174 FEBS Journal 277 (2010) 174–185 ª 2009 The Authors Journal compilation ª 2009 FEBS
high temperature extreme [10,11]. The first report of a
cold-induced heat shock response in insects was pro-
vided by Burton et al. [12], who noticed the induction
of a 70 kDa protein after a cold treatment. However,
the biochemical diversity of cold-induced heat shock
responses remains poorly understood, because much of

Drosophila melanogaster during both the cold stress
exposure phase and the recovery phase.
Results and Discussion
Adult flies were subjected to prolonged cold stress for
up to 9 h at 0 °C, and then allowed to recover at
25 °C for up to 8 h, with or without food (Fig. 1). We
investigated the temporal expression patterns of 11
Hsp genes during both the cold stress phase and the
recovery phase, using quantitative RT-PCR (qRT-
PCR). At 0 °C, adults fall directly into chill coma,
because of the inability to maintain muscle resting
potentials [25]. In addition to this neuromuscular per-
turbation, chilling injuries accumulate at low tempera-
tures as a result of various physiological dysfunctions,
recently reviewed by Chown and Terblanche [26].
Within certain limits, these physiological injuries are
reversible. As previously noted in D. melanogaster [27],
when the cold stress period is increased, the associated
chilling injuries accumulate, and the time needed for
recovery increases. In our experiments, recovery times
(Fig. 2) followed periods of stress exposure, increasing
significantly with time spent at 0 °C (ANOVA;
F = 239.2; degrees of freedom = 3,156; P < 0.0001).
Recovery time is a highly variable physiological trait.
We observed that coefficients of variation ranged from
10% to 13% for stress duration of 0.25–6 h, and then
increased to 28% for 9 h of cold stress. As often
observed in animals, the phenotypic variability of a
trait increases rather than decreases when the level of
stress becomes more severe [7]. There was no mortality

than those of Hsp70, accumulate during cold stress.
All qRT-PCR assays yielded specific products (i.e. sin-
gle melting peak), and qRT-PCR efficiencies were
between 80% and 101%. There was no difference in
the relative expression of the housekeeping gene RpS20
between all treatment–duration combinations, includ-
ing controls (ANOVA; F = 0.656; degrees of free-
dom = 11,30; P = 0.766).
Hsp70 and Hsp68
Of the 11 Hsp genes examined, Hsp70Aa and Hsp68
were the most cold-inducible, with overall expression
being treatment-specific, and expression being upregu-
lated during recovery treatments (Table 2 and Fig. 3).
Hsp70Aa was only marginally upregulated towards the
end of the cold stress, but was upregulated 68-fold
after 2 h of recovery. Upon commencement of the
25 °C recovery, the accumulation of Hsp68 transcripts
underwent a 0.5 h delay before peaking at 2 h of
recovery with 22-fold upregulation. Goto and Kimura
[28] also found that in some temperate species of Dro-
sophila, Hsp70 mRNA accumulated after the flies were
returned to 23 °C following cold treatment. The only
exception was Drosophila watanabei, where a low level
of upregulation of Hsp70 mRNA was observed, not
only during cold exposure, but also during recovery
from cold. Using RNA interference (RNAi), recent
studies on other insect species have demonstrated that
Hsp70 is critically important for cold survival [29,30].
Hsp68, which belongs to the Hsp70 family, was highly
expressed during recovery. Hsp68 is induced by heat

Hsp60 (reverse) GGAGGAGGGCATCTTGGAACTC
Hsp67Ba (forward) TGGATGAACCCACACCCAATC 89
Hsp67Ba (reverse) CGAGGCAACGGGCACTTC
Hsp68 (forward) GAAGGCACTCAAGGACGCTAAAATG 88
Hsp68 (reverse) CTGAACCTTGGGAATACGAGTG
Hsp70Aa (forward) TCGATGGTACTGACCAAGATGAAGG 98
Hsp70Aa (reverse) GAGTCGTTGAAGTAGGCTGGAACTG
Hsc70-1 (forward) TGCTGGATGTCACTCCTCTGTCTC 87
Hsc70-1 (reverse) TGGGTATGGTGGTGTTCCTCTTAATC
Hsp83 (forward) GGACAAGGATGCCAAGAAGAAGAAG 150
Hsp83 (reverse) CAGTCGTTGGTCAGGGATTTGTAG
Fig. 3. Mean relative expression (+standard error), based on log
2
transformation of qRT-PCR ratios of the assayed Hsp genes relative to
RpS20. White bars represent flies exposed to cold stress (S) for periods ranging from 0.25 to 9 h (S05–S9). Gray and black bars represent
flies recovering from 9 h of cold stress at 25 °C with food (RF) or agar (RA), respectively, for periods ranging from 0.5 to 8 h (R05F–R8F and
R05A–R8A). The symbol (w) indicates mean values that are significantly (P < 0.05) different from 0. A value equal to 0 indicates no differ-
ence in expression level from control flies, whereas positive and negative values indicate upregulation and downregulation, respectively.
Heat shock response to cold stress H. Colinet et al.
176 FEBS Journal 277 (2010) 174–185 ª 2009 The Authors Journal compilation ª 2009 FEBS
H. Colinet et al. Heat shock response to cold stress
FEBS Journal 277 (2010) 174–185 ª 2009 The Authors Journal compilation ª 2009 FEBS 177
during the recovery period (Table 2 and Fig. 3), with-
out a lag period; expression was already significantly
different from that of the control after 0.5 h of recov-
ery (P < 0.05). A peak of Hsp40 expression was
observed after 2 h of recovery. Hsp40 is known to
respond to heat stress in Drosophila [23,33], but this
particular Hsp gene has not previously been reported
to be cold-inducible. Hsp40 is an essential cofactor

ranging from four-fold to eight-fold (Fig. 3).
Only a few studies have analyzed sHsp expression in
relation to cold stress in insects. Yocum et al. [39]
found that expression of the Hsp23 transcript of the
nondiapausing flesh fly was induced in response to
both severe heat and cold shocks (43 °C and )10 °C
for 2 h). Sinclair et al. [17] did not observe any modu-
lation of Hsp23 transcription during recovery from a
short cold stress (3 h at 0 °C) in D. melanogaster. Per-
haps, as for Hsp70 [12], it takes several hours under
mild cold stress to obtain a response in sHsp genes.
However, in the same species, Qin et al. [40] reported
the upregulation of Hsp23 and Hsp26 during a 30 min
recovery phase preceded by a cold stress of only 2 h at
0 °C. In the present study, flies were stressed for 9 h at
0 °C, and we observed upregulation of four sHsp genes
during recovery. The reason why D. melanogaster has
four structurally similar sHsps is still unclear [41]. In
addition to their molecular chaperone function, sHsps
are involved in various processes [4], some of which
are important for insect cold tolerance. Suppressing
the expression of Hsp23 by using RNAi undermines
insect survival at low temperature [29]. Our expression
results suggest that sHsps may play an important role
in cold tolerance. Hsp22 is a key player in cell protec-
tion against oxidative injuries [42], a typical feature of
chilling injury [43]. In addition, sHsps are effective in
preserving the integrity of the actin cytoskeleton and
microfilaments [44]. This function is particularly
important, because there is increasing evidence that

[23,32], but it increases the expression of Hsp60 in the
blowfly [48]. Our data indicate that cold stress does
not upregulate transcriptional expression of Hsp60,
suggesting that this gene is not induced by thermal
stress (heat and cold), at least in D. melanogaster.
Hsc70, a member of the Hsp70 family, is constitutively
expressed under nonstress conditions [2]. In insects,
Hsc70 displays species-specific transcriptional changes
in response to heat stress, being either induced [50,51]
or not induced [23,52]. The response of Hsc70 to cold
stress is poorly documented. In the flesh fly, transcrip-
tion of Hsc70 is upregulated by cold shock and not by
heat shock [52]. In the rice stem borer, the level of
Hsc70 mRNA decreases slightly during cold acclima-
tion [37]. In mites, the level of Hsc70 transcript is not
changed by heat or cold shock, or by recovery after
either shock [53]. We found that, in D. melanogaster,
cold stress does not modulate the transcriptional
expression of Hsc70-1. Finally, the multicopy gene
Hsp67 is not responsive to cold stress. There are no
data on this gene in the cold stress-related literature.
In Drosophila, expression of Hsp67 is upregulated by
heat stress [32,33]. Therefore, it seems that, unlike the
other Hsp genes tested here, Hsp67 does not respond
similarly to heat and cold stress. The absence of tran-
scriptional change in expression in these three Hsp
genes suggests that they do not contribute to the cold
repair or cold acclimation machinery. However, we
cannot exclude the possibility of potential translational
or post-translational regulation.

expression of Hsps during recovery from cold might
result from the thermal stress experienced during the
upshift in temperature [12]. However, other results have
shown that cold itself acts as a cue for the induction
[28]. The maximum expression levels were only attained
when flies were returned to an optimal temperature
(peak after 2 h). The functional explanation for this
delay is unknown, but it may reflect the strong repres-
sion of metabolic activity at low temperature.
An additional test was performed to address the
possible repair ⁄ protective function of Hsps during the
recovery phase. On the basis on recovery times
(Fig. 4), flies exposed to constant cold for 16 h were
Fig. 4. Sigmoid models describing the cumulative proportion of
flies recovering (Y) in relation to time spent after cold stress (X).
Circles: 8 h treatment (i.e. 8 h of cold stress). Squares: 8 + 3 + 8 h
treatment (i.e. two successive cold stresses of 8 h separated by
3 h of recovery). Triangles: 16 h treatment (i.e. 16 h of cold stress).
The equation Y = A ⁄ [1 + 10
(log B–X)C
] was used to fit the data,and
to estimate the following parameters: A, which represents the pla-
teau; B, which represents the halfway point between the bottom
and the top; and C represents the slope. Adjusted coefficients of
determination (r
2
) are provided for each group.
H. Colinet et al. Heat shock response to cold stress
FEBS Journal 277 (2010) 174–185 ª 2009 The Authors Journal compilation ª 2009 FEBS 179
the most affected (16 h treatment), followed by flies

´
-Borovanska
´
[30]; and (b) no role of Hsp
upregulation in protective functions, supporting the
ideas of Nielsen et al. [57]. In addition to Hsps, the
expression of other genes, proteins or metabolites
could be regulated during the recovery from cold
[16,19,20], and may be responsible for repair processes
during recovery.
Because flies are immobilized at 0 °C (chill coma),
long-term cold stress may damage flies though a com-
bination of temperature and starvation stresses. In
mites, the Hsc70 mRNA level decreases as a result of
food restriction [53]. In Drosophila, Hsp26, Hsp27 and
Hsp70 are upregulated after 58 h of starvation [58].
Sinclair et al. [17] analyzed the response of Hsp70 and
Hsp23 transcripts after a 5 h starvation period, and
neither showed any expression modulation. In our
experimental design, flies were starved at 0 °C for 9 h,
and then allowed to recover with or without food for
8 h. Therefore, flies recovering without food experi-
enced a total starvation period of 17 h. We did not
observe any difference between these two conditions in
the expression of the 11 genes analyzed, suggesting
that starvation stress was not severe and ⁄ or long
enough to cause any differential Hsp expression.
The response of D. melanogaster to low temperature
is complex and still not fully understood, despite the
availability of new molecular tools [59]. The current

sion) lines will help us to better understand the
relationship between Hsps and cold tolerance.
Experimental procedures
Fly culture
We conducted our experiments on a mass-bred D. melano-
gaster population derived from about 50 females collected
in Innisfail (Australian east coast, 17°33¢S) in May 2008.
Flies were maintained in 250 mL bottles for 15 generations
at 19 °C and 70% relative humidity under continuous light
on a medium that contained yeast (3.2% w ⁄ v), agar (3.2%)
and sugar (1.6%) standard fly medium [62]. The fly density
was kept at approximately 500 individuals per bottle. Flies
were transferred at 25 °C for three generations at the time
of experiments.
Conditions for cold stress and recovery
Both sex and age can differentially affect cold resistance
and Hsp expression [5]. Therefore, all tests were performed
using synchronized 4-day-old virgin males. CO
2
anesthesia
is a standard technique used to sex Drosophila flies. How-
Heat shock response to cold stress H. Colinet et al.
180 FEBS Journal 277 (2010) 174–185 ª 2009 The Authors Journal compilation ª 2009 FEBS
ever, there is increasing evidence that anesthesia interacts
with stress recovery [63]. Therefore, to avoid any potential
confusing effect on Hsp gene expression, all flies were sexed
without CO
2
within an 8 h window after eclosion.
For measurement of gene expression during the cold stress

ture on the time required to recover, we used the method
described in Hoffmann et al. [64]. Briefly, for each cold
stress duration (i.e. 0.25, 3, 6 and 9 h), 40 males were
allowed to recover at 25 °C, and the recovery time was
recorded. Flies were considered to have recovered when
they stood up.
RNA extraction and reverse transcription
Flies were ground to fine powder in 1.5 mL tubes placed in
liquid nitrogen. Samples were mixed with 600 lL of lysis
buffer (containing 1% b-mercaptoethanol) from RNeasy
RNA extraction kits (Qiagen Pty, Doncaster, Australia) and
vortexed for 3–5 min to complete homogenization. RNA
extraction and purification was performed using an RNeasy
spin column (Qiagen), following the manufacturer’s instruc-
tions. Optional on-column DNase digestion was performed
to remove any potential genomic DNA contamination, using
an RNase-Free DNase Set (Qiagen). Total RNA was eluted
in 30 lL of diethylpyrocarbonate-treated water. RNA was
quantified and quality-checked with a UV spectrophotometer
(Gene Quant Pro, Amersham Bioscience, Analytical Instru-
ments, Golden Valley, MN, USA) (criteria: A
260 nm
⁄ A
230 nm
> 1.85; A
280 nm
⁄ A
260 nm
> 1.85). The integrity of RNA (i.e.
the presence of twp intense rRNA bands) was examined by

t
), estimates were obtained using the absolute quantifi-
cation module in the software package. The PCR reactions
were performed in a final volume of 10 lL containing 1 lL
of cDNA sample, 0.4 lm each primer, and 5 lL of the 2·
High Resolution Melting Master Mix. After 10 min at
95 °C, the cycling conditions were as follows: 60 cycles at
95 °C for 10 s, 60 °C for 15 s, and 72 °C for 15 s. To vali-
date the specificity of amplification, a postamplification melt
curve analysis was performed. Amplicons were first dena-
tured at 95 °C for 1 min, and then cooled to 65 °C, and the
temperature was then gradually raised to 95 °C in incre-
ments of 0.02 °CÆs
)1
. Fluorescence data were recorded con-
tinuously during this period, and subsequently analyzed
using the T
m
calling module in the LightCycler 480 soft-
ware.
Ratio ¼
ðE
target
ÞDC
ðcontrolÀtreatedÞ
p target
=ðE
reference
ÞDC
ðcontrolÀtreatedÞ

determine the efficiency of every individual reaction. It has
been established that this method provides the best preci-
sion for real-time PCR efficiency estimation [68,69].
Additional test
To address the functional role of Hsps during the recovery
phase, we compared the time to recovery of flies exposed to
three different cold stress treatments: constant 0 °C for 8 h
(8 h treatment), or 0 °C for 8 h followed by 3 h of recovery
at 25 °C and then another 8 h at 0 °C (8 + 3 + 8 h treat-
ment), or constant 0 °C for 16 h (16 h treatment). In the
8 + 3 + 8 h treatment, flies experienced a total cold stress
duration of 16 h, but the short pulse at 25 °C allows the
upregulation of Hsp genes (as observed in the present
study). All flies used were 4-day-old males, as described
previously. The hypotheses advanced were as follow. If
expression of Hsp genes during recovery has a repair func-
tion, the recovery time should be less after the
8 + 3 + 8 h treatment than after the 16 h treatment. The
Hsp induction requires exposure to a rather long period of
cold stress [12]. If this cold stress period has no physiologi-
cal cost, because of complete repair during the recovery,
the time to recover should be similar after the 8 h and the
8 + 3 + 8 h treatments. Finally, if the induction of Hsp
genes during recovery has a protective function, the recov-
ery time after the 8 + 3 + 8 h treatment should be less
than after the 8 h treatment. We used 45 flies in each
group, and recovery times were recorded at 25 °C over a
maximum period of 90 min (as described before). The pro-
portion of flies that had recovered was cumulated over
time, giving a sigmoid-shaped function. A nonlinear regres-

DNA sequence variation and latitudinal associations in
hsp23, hsp26 and hsp27 from natural populations of
Drosophila melanogaster . Mol Ecol 12, 2025–2032.
5 Sørensen JG, Kristensen TN & Loeschcke V (2003) The
evolutionary and ecological role of heat shock proteins.
Ecol Lett 6, 1025–1037.
6 Parsell DA & Lindquist S (1993) The function of
heat-shock proteins in stress tolerance: degradation and
reactivation of damaged proteins. Annu Rev Genet 27,
437–496.
7 Hoffmann AA & Parsons PA (1991) Evolutionary
Genetics and Environmental Stress. Oxford University
Press, New York.
8 Tammariello SP, Rinehart JP & Denlinger DL (1999)
Desiccation elicits heat shock protein transcription in
the flesh fly, Sarcophaga crassipalpis , but does not
enhance tolerance to high or low temperatures. J Insect
Physiol 45, 933–938.
9 Al-Fageeh MB & Smales CM (2006) Control and regu-
lation of the cellular responses to cold shock: the
responses in yeast and mammalian systems. Biochem J
397, 247–259.
10 Norry FM, Gomez FH & Loeschcke V (2007) Knock-
down resistance to heat stress and slow recovery from
chill coma are genetically associated in a central region
Heat shock response to cold stress H. Colinet et al.
182 FEBS Journal 277 (2010) 174–185 ª 2009 The Authors Journal compilation ª 2009 FEBS
of chromosome 2 in Drosophila melanogaster. Mol Ecol
16, 3274–3284.
11 Sørensen JG & Loeschcke V (2007) Studying stress

Hance T (2007) Proteomic profiling of a parasitic wasp
exposed to constant and fluctuating cold exposure.
Insect Biochem Mol Biol 37, 1177–1188.
20 Lalouette L, Kos
ˇ
ta
´
l V, Colinet H, Gagneul D & Rena-
ult D (2007) Cold-exposure and associated metabolic
changes in adult tropical beetles exposed to fluctuating
thermal regimes. FEBS J 274, 1759–1767.
21 Michaud MR & Denlinger DL (2004) Molecular modal-
ities of insect cold survival: current understanding and
future trends. Int Congress Ser 1275, 32–46.
22 Neal SJ, Karunanithi S, Best A, So AK, Tanguay RM,
Atwood HL & Westwood JT (2006) Thermoprotection
of synaptic transmission in a Drosophila heat shock fac-
tor mutant is accompanied by increased expression of
Hsp83 and DnaJ-1. Physiol Genomics 25, 493–501.
23 Bettencourt BR, Hogan CC, Nimali M & Drohan BW
(2008) Inducible and constitutive heat shock gene
expression responds to modification of Hsp70 copy
number in Drosophila melanogaster but does not com-
pensate for loss of thermotolerance in Hsp70 null flies.
BMC Biol 6, 5, doi:10.1186/1741-7007-6-5.
24 Duncan RF (2005) Inhibition of Hsp90 function delays
and impairs recovery from heat shock. FEBS J 272,
5244–5256.
25 Hosler JS, Burns JE & Esch HE (2000) Flight muscle
resting potential and species-specific differences in chill

Cell Biol 6, 1187–1203.
32 Sørensen JG, Nielsen MM, Kruhøffer M, Justesen J &
Loeschcke V (2005) Full genome gene expression analy-
sis of the heat stress response in Drosophila melanogas-
ter. Cell Stress Chap 10, 312–328.
33 Leemans R, Egger B, Loop T, Kammermeier L, He H,
Hartmann B, Certa U, Hirth F & Reichert H (2000)
Quantitative transcript imaging in normal and
heat-shocked Drosophila embryos by using high-density
oligonucleotide arrays. Proc Natl Acad Sci USA 97,
12138–12143.
34 Laufen T, Mayer MP, Beisel C, Klostermeier D, Rein-
stein J & Bukau B (1999) Mechanism of regulation of
Hsp70 chaperones by DnaJ co-chaperones. Proc Natl
Acad Sci USA 96, 5452–5457.
35 Xiao H & Lis T (1989) Heat shock and developmental
regulation of the Drosophila melanogaster hsp83 gene.
Mol Cell Biol 9, 1746–1753.
36 Chen B, Kayukawa T, Monteiro A & Ishikawa Y
(2005) The expression of the HSP90 gene in response to
winter and summer diapauses and thermal-stress in the
onion maggot, Delia antiqua. Insect Mol Biol 14, 697–
702.
37 Sonoda S, Fukumoto K, Izumi Y, Yoshida H &
Tsumuki H (2006) Cloning of heat shock protein genes
(hsp90 and hsc70) and their expression during larval
diapause and cold tolerance acquisition in the rice stem
H. Colinet et al. Heat shock response to cold stress
FEBS Journal 277 (2010) 174–185 ª 2009 The Authors Journal compilation ª 2009 FEBS 183
borer, Chilo suppressalis Walker. Arch Insect Biochem

Insect Mol Biol 18, 295–302.
46 Concannon CG, Gorman AM & Samali A (2003) On the
role of Hsp27 in regulating apoptosis. Apoptosis 8, 61–70.
47 Yi SX, Moore CW & Lee RE (2007) Rapid cold-hard-
ening protects Drosophila melanogaster from cold-
induced apoptosis. Apoptosis 12, 1183–1193.
48 Sharma S, Reddy PVJ, Rohilla MS & Tiwari PK (2006)
Expression of HSP60 homologue in sheep blowfly Lucil-
ia cuprina during development and heat stress. J Therm
Biol 31, 546–555.
49 Norry FM, Sambucetti P, Scannapieco AC, Gomez FH
& Loeschcke V (2007) X-linked QTL for knockdown
resistance to high temperature in Drosophila melanogas-
ter. Insect Mol Biol 16, 509–513.
50 Sonoda S, Ashfaq M & Tsumuki H (2006) Cloning and
nucleotide sequencing of three heat shock protein genes
(hsp90, hsc70, and hsp19.5) from the diamondback
moth, Plutella xylostella (L.) and their expression in
relation to developmental stage and temperature. Arch
Insect Biochem Physiol 62, 80–90.
51 Wang H, Dong SZ, Li K, Hu C & Ye GY (2008) A
heat shock cognate 70 gene in the endoparasitoid,
Pteromalus puparum, and its expression in relation to
thermal stress. BMB Rep 41, 388–393.
52 Rinehart JP, Yocum GD & Denlinger DL (2000) Devel-
opmental upregulation of inducible hsp70 transcripts,
but not the cognate form, during pupal diapause in the
flesh fly, Sarcophaga crassipalpis. Insect Biochem Mol
Biol 30, 515–521.
53 Shim JK, Jung DO, Park JW, Kim DW, Ha DM &

Z (2009) The small heat shock protein (sHSP) genes in
the silkworm, Bombyx mori, and comparative analysis
with other insect sHSP genes. BMC Evol Biol 9, 215,
doi:10.1186/1471-2148-9-215.
62 Hoffmann AA & Shirriffs J (2002) Geographic varia-
tion for wing shape in Drosophila serrata. Evolution 56,
1068–1073.
63 Nilson TL, Sinclair BJ & Roberts SP (2006) The effects
of carbon dioxide anesthesia and anoxia on rapid
cold-hardening and chill coma recovery in Drosophila
melanogaster. J Insect Physiol 52, 1027–1033.
64 Hoffmann AA, Anderson A & Hallas R (2002) Oppos-
ing clines for high and low temperature resistance in
Drosophila melanogaster .
Ecol Lett 5, 614–618.
65 Pfaffl MW (2001) A new mathematical model for rela-
tive quantification in real-time RT-PCR. Nucleic Acids
Res 29 , 2002–2007.
66 Ingerslev HC, Pettersen EF, Jakobsen RA, Petersen CB
& Wergeland HI (2006) Expression profiling and valida-
Heat shock response to cold stress H. Colinet et al.
184 FEBS Journal 277 (2010) 174–185 ª 2009 The Authors Journal compilation ª 2009 FEBS
tion of reference gene candidates in immune relevant
tissues and cells from Atlantic salmon (Salmo salar L.).
Mol Immunol 43, 1194–1201.
67 Sitzler S, Oldenburg I, Petersen G & Bautz EKF
(1991) Analysis of the promoter region of the house-
keeping gene DmRP140 by sequence comparison of
Drosophila melanogaster and Drosophila virilis. Gene
100, 155–162.


Nhờ tải bản gốc

Tài liệu, ebook tham khảo khác

Music ♫

Copyright: Tài liệu đại học © DMCA.com Protection Status