Physicochemical properties and distinct DNA binding
capacity of the repressor of temperate
Staphylococcus aureus phage /11
Tridib Ganguly*, Malabika Das*, Amitava Bandhu, Palas K. Chanda, Biswanath Jana, Rajkrishna
Mondal and Subrata Sau
Department of Biochemistry, Bose Institute, Calcutta, India
The basic regulatory elements that most temperate
phages use for the establishment and maintenance of
their lysogeny are the phage-encoded repressor and the
cognate operator DNA [1–12]. A temperate phage
generally enters into the lysogenic life cycle once
its repressor inhibits the transcription of the phage-
specific lytic genes from the early promoter by binding
to the overlapped operator DNA. Repressors of the
temperate phages, although varying greatly in size and
in primary sequence level, mostly harbor a DNA bind-
ing domain and an oligomerization domain. The size
and type of the operator DNAs also vary from phage
to phage. Although some repressors bind to operators
with dyad symmetry [1,5–9] or operators with direct
repeats [10], other repressors bind to asymmetric oper-
ators [2,3,11–13] to establish lysogeny. Interestingly,
the repressor of Vibrio cholerae phage CTX/ binds to
extended operators, stopping lytic growth, as well as
ensuring lysogeny of this phage [4]. Although these
regulatory elements have enriched both basic and
applied molecular biology enormously, they have not
been cloned from most temperate phages or character-
ized in any depth.
The temperate Staphylococcus aureus phage /11 [14]
harbors the cI and cro genes in a divergent orientation
O1 and O2 in a cooperative manner and was found to bind to operator
DNA as a homodimer. Interestingly, CI did not show appreciable binding
to another homologous 15 bp site (O3) that was located in the same
primary immunity region as O1 and O2. Taken together, these results sug-
gest that /11 CI and the /11 CI–operator complex resemble significantly
those of the lambdoid phages at the structural level. The mode of action of
/11 CI, however, may be distinct from that of the repressor proteins of k
and related phages.
Abbreviations
CI, repressor of temperate Staphylococcus aureus phage /11; CTD, C-terminal domain; DMS, dimethyl sulfate; DTNB, 5,5¢-dithiobis-(2-
nitrobenzoic acid); NTD, N-terminal domain.
FEBS Journal 276 (2009) 1975–1985 ª 2009 The Authors Journal compilation ª 2009 FEBS 1975
ate S. aureus phages, such as /PVL, /13, /53, 3A, 77
and /Sa3ms [14–17]. By contrast, the 239 amino acid
product of the /11 cI gene shows a moderate homol-
ogy over the entire length of the k repressor. Interest-
ingly, although the sequences of the C-terminal ends of
the above S. aureus phage repressors are identical, the
sequences of their N-terminal ends vary considerably
[15]. The predicted secondary structures of the repres-
sors of S. aureus phages show a notable similarity to
that of k repressor, especially at the C-terminal ends.
As noted with the C-terminal end of k repressor [1],
the C-terminal ends of the repressors of S. aureus
phages may be involved in oligomerization. The N-ter-
minal half of /11 repressor carries a putative helix-
turn-helix DNA binding motif similar to that of
lambdoid phages, indicating that this half of the /11
repressor most likely participates in the binding of
operator DNA. An N-terminal histidine-tagged form
column chromatography-purified CI [15] to gel filtra-
tion chromatography (for details, see Experimental
procedures), analyzed the resulting protein containing
elution fractions by 13.5% SDS ⁄ PAGE (Fig. 1A) and
found that only fractions F2 and F3 (loaded in lanes 2
and 3) contain intact CI with an estimated purity of
almost 98%. The overall yield of CI was approxi-
mately 1 mgÆL
)1
of induced E. coli culture. Because
the above highly-purified CI did not show any degra-
dation upon storage on ice for more than 1 month and
possessed operator DNA binding activity (described
below), it was utilized in all the in vitro experiments
performed in the present study.
To map the possible flexible region or domain struc-
ture in CI, we performed a partial proteolysis of CI by
trypsin and found that protein fragments I and II were
the two major products generated from CI at a very
early stage of the enzymatic cleavage (Fig. 1B). Both
the fragments remained mostly undigested throughout
the entire period of digestion. Interestingly, limited
proteolysis of CI with chymotrypsin also generated a
similar digestion pattern (data not shown). Neither of
the above fragments interacted with anti-(his Ig) (data
not shown), indicating the loss of the N-terminal histi-
dine tag from CI immediately after exposure to the
enzyme. The first three N-terminal end amino acid
residues of fragment I were determined to be LVS
(corresponding to amino acid residues 156–158 of CI),
(r.m.s.d. = 0.46 A
˚
) [18] and to k CI CTD (r.m.s.d. =
1.09 A
˚
) [19]. Similarly, the NTD (Fig. 1D) generated
with residues 10–69 of the native /11 repressor exhib-
ited structural similarity to a putative DNA-binding
protein from Bacteriodes fragilis (r.m.s.d. = 0.06 A
˚
)
and to the NTD of k CI (r.m.s.d. = 1.43 A
˚
) [20].
The CD spectrum of /11 CI showed a peak of large
negative ellipticity at 208 nm and 25 °C, indicating
the presence of a-helix in CI at room temperature
(Fig. 1E). Analysis of the spectrum by CD neural
networks [21] revealed approximately 23.6% a-helix
and 18.5% b-sheet in CI at 25 °C. The above CD data
are as expected because the NTD and CTD of /11 CI
are mostly composed of a-helix and b-sheet
(Fig. 1C,D). The peaks in the CD spectra of CI at
208 nm, however, were reduced substantially once the
incubation temperature of CI was raised above 39 °C
(Fig. 1C). The plot of molar ellipticity at 222 nm ver-
sus the incubation temperature (Fig. 1C, inset) shows
that the melting temperature of CI is close to 41 °C.
At this temperature, the concentration ratio of native
12345678
m
25
–14
–10
Ellipticity
(222 nM)
–6
≈
33 41 49
Wavelen
g
th (nm)
240 260
Min
0º
5º
15º
30º
60º
90º
120º
150º
180º
kDa
Tr y
I
II
–+++++ +++
kDa
tents in /11 CI are significantly less than that in
k repressor. Several studies have demonstrated that a
higher alanine and ⁄ or proline content contributes sig-
nificantly to the enhanced thermostability of various
proteins, including phage repressor [22–24].
/11 CI carries three cysteine residues at positions 125,
159 and 207 [14]. To obtain clues about the status (bur-
ied versus exposed) of these cysteine residues, we deter-
mined the free sulfhydryl group content in CI by the
5,5¢-dithiobis-(2-nitrobenzoic acid) (DTNB) test and
found that the number of free thiols in CI is almost 1.5,
indicating that two cysteine residues are partially
exposed to its surface. The putative surface structure of
CTD of /11 CI (data not shown) reveals that cysteine
125 and cysteine 207 are approximately 27% and 30%
surface exposed, respectively, whereas, cysteine 159 is
mostly buried. The former two cysteine residues most
likely showed reactivity with DTNB. Interestingly, k CI
also harbors three cysteine residues in its CTD, but none
of them are exposed to the surface [25].
Cooperative binding of CI to two sites in the /11
cI-cro intergenic region
To identify the precise location of the repressor binding
sites in the primary immunity region of /11 (Fig. 2A),
we performed a DNase I footprinting experiment using
200 nm CI and radioactively labeled O DNA (Fig. 2B).
The footprints of both the top and bottom strands of O
DNA reveal that two regions in O DNA became resis-
tant to digestion by DNase I in the presence of CI. More
precisely, the )21 to )48 and )52 to )87 regions of
binding of CI to O3 is nonspecific in nature. Interest-
ingly, /11 Cro that neither binds to O1 or O2 demon-
strates specific binding to O3 DNA [26].
To determine whether the binding of CI to O1 and O2
is cooperative in nature, we also studied the equilibrium
binding of CI to radiolabeled O1O2 DNA by a gel shift
assay. It was found that the O1O2 DNA formed two
shifted complexes (1 and 2) with increasing CI concen-
trations (Fig. 2I). The complex 1 appears at 3nm,
reaching a maximum at 46 nm and starts disappear-
ing at higher CI concentrations. By contrast, complex 2
is barely detectable at 10 nm and starts appearing as
the predominant form only when the intensity of com-
plex 1 declines at more than 50 nm CI. Complex 1
was estimated to contain 36% of the labeled O1O2
DNA at 46 n
m CI (Fig. 2J). Under these conditions, the
extent of labeled O1O2 DNA that remained in free form
or was retained in complex 2 was determined to be
approximately 30%. Using the above data, the cooper-
ativity parameter was calculated to be approximately 5
(for details, see Experimental procedures), indicating
that binding of CI to O1 causes an approximately five-
fold increase of the binding affinity of CI to O2, which is
18 bp away from the former operator (Fig. 3B).
Only 15 bp O1 and O2 interact with CI
To confirm that the 15 bp O1 and O2 operators inter-
act with CI, we performed the guanine base-specific
dimethyl sulfate (DMS) protection assay in the
presence ⁄ absence of saturating amounts of CI and
O1
O1
O2
O1
O
2
G
0
15
0
0
0
3
10
25
50
75
100
50
100
250
500
1000
0
50
100
250
500
1000
0
FI
J
G
H
(n
M
)
[CI] (n
M
)
[CI] (n
M
)
[CI]
(n
M
)
[CI]
(n
M
)
O1O2
100
75
f
2
1
50
25
% O1O2
within the protected regions are indicated by solid bars. (C, D, F–I) Autoradiograms of different gel shift assays. Each autoradiogram repre-
sents the gel shift assay with a specific
32
P-labeled DNA (noted in the left bottom corner) and the indicated amounts of CI. All gel shift
assays were performed three of four times and only representative data are presented. The arrow and asterisk indicate the shifted complex
and contaminating band, respectively. (E) Using the scanned data from the autoradigrams (C, D), plots of percent operator bound versus
repressor concentration were generated. Curves O1 and O2 denote the equilibrium binding of CI to O1 and O2 DNA respectively. (J). Coop-
erative binding: the operator DNA contents in the shifted complexes 1 and 2 and in the unbound labeled O1O2 DNA were determined by
scanning the intensities of all the bands shown in the autoradiogram of the gel shift assay (I) and plotted against the respective repressor
concentrations. Curves 1, 2 and f denote the status of O1O2 DNA concentrations in complexes 1 and 2 and in the unbound state. The maxi-
mum amount of bound operator in complex 1 was estimated from curve 1. The amounts of operator in complex 2 and in the unbound state
at the condition of maximum bound operator in complex 1 were determined from curves 2 and f, respectively. All these values were used
for calculation of the cooperativity parameter by a standard method (see Experimental procedures). All curves are best-fit curves.
T. Ganguly et al. Characterization of /11 repressor
FEBS Journal 276 (2009) 1975–1985 ª 2009 The Authors Journal compilation ª 2009 FEBS 1979
that the intensities of six bottom strand guanine bases
and five top strand guanine bases of O DNA are
decreased notably in the presence of CI. The guanines
protected by CI correspond to )41G, )43G, )63G,
)67G, )74G and )76G (bottom strand) and )33G,
)35G, )46G, )56G and )68G (top strand) (Fig. 3B).
All the protected guanine bases except )56G are
located in and around O1 and O2. Interestingly,
)35G, )41G and )43G in O1 and )68G, )74G and
)76G in O2 are conserved. The )40G in O1 and )73G
in O2, although conserved, most likely do not interact
with the CI. The data, however, confirm that 15 bp O1
and O2 DNAs are involved in the binding of CI. The
intensities of some top ()53G) and bottom ()36G and
)49G) strand guanine bases were also increased nota-
overlap with the 15 bp O2 site (data not shown).
Taken together, this suggests that the transcription of
/11 cI is most possibly regulated by O2 alone and O3
is needed merely to stop the transcription of /11 cI by
/11 Cro (which favors the lytic development of /11).
Binding stoichiometry
To determine the CI binding stoichiometry precisely,
we performed glutaraldehyde-mediated crosslinking
experiments with CI in the presence ⁄ absence of varying
amounts of O1 DNA. As shown in Fig. 4A, dimeric
CI is the predominant form formed in the presence of
O1 DNA. Although the tetrameric and hexameric
forms of CI (formed without O1 DNA) disappeared, a
small amount of monomeric CI reappeared in the
presence of O1 DNA. The reason for the presence of
[CI]
AB
[CI]
+
*
*
*
*
*
**
*
To p
Bottom
O1
O2
arrows. The first base of the start codon of Cro was considered as +1 and the whole sequence was numbered with respect to +1.
Characterization of /11 repressor T. Ganguly et al.
1980 FEBS Journal 276 (2009) 1975–1985 ª 2009 The Authors Journal compilation ª 2009 FEBS
operator DNA slightly slowing down the migration of
dimeric CI remains unclear at present.
To confirm that dimeric repressor binds to a single
operator, we carried out gel shift assays under condi-
tions (i.e. using very high CI and O1 DNA concentra-
tions) that strongly favor the formation of the CI–O1
complex (Fig. 4B). The corresponding plot of CI bind-
ing to O1 DNA, as obtained from quantitation of the
gel shift data, is also shown (Fig. 4C). It is apparent
that the binding stoichiometry is approximately two
CI monomers per O1 DNA. Taken together, the data
suggest that, similar to k CI and Cro [8] /11, CI binds
to 15 bp operator DNA as a homodimer.
The CTDs of k CI [1] and LexA [18] (i.e. the struc-
tural homologs of /11 CTD) are involved in the
homodimerization of these repressors. Sequence align-
ment of /11 CI and LexA revealed that several resi-
dues involved in the dimerization of LexA CTD were
also present in the CTD of /11 CI (data not shown).
The CTDs of two /11 CI monomers may therefore be
responsible for the formation of a dimeric /11 CI [15].
By contrast, the NTD of /11 CI, which harbors a
potential helix-turn-helix DNA binding motif, could
participate in the binding of the dimeric /11 CI to the
major groove of operator DNA helix (Fig. 3A). The
average size of each DNase I-protected region of oper-
ator DNA was found to be approximately 25–27 bp
CTD CTD
NTD
NTD
[CI]
0 0 4 20 40 M
200
150
120
100
70
50
40
30
120
100
80
60
40
20
0
% O1 DNA bound
0 1
[CI]/[O1 DNA]
2 3
60
85
kb
0 0.2 0.3 0.4 0.5 0.6 0.7 0.8 1.0 2.0
+ + + + –
Fig. 4. Binding stoichiometry. (A) 10% SDS ⁄ PAGE analysis of glutaraldehyde (GCHO) treated CI. 4 lM CI was incubated with the indicated
been described previously [32]. The construction of plasmid
pSAU1201 and pSAU1220 was also described previously
[15]. The 269 bp /11 DNA insert in pSAU1201 carrying
the /11 cI-cro intergenic region was designated as O DNA.
Plasmid pSAU1220 was utilized for overexpression of /11
CI in E. coli.
Molecular biological techniques
Plasmid DNA isolation, DNA estimation, digestion of
DNA by restriction enzymes, modification of DNA frag-
ments by modifying enzymes, PCR, purification of DNA
fragments, labeling of DNA fragments with radioactive
materials and agarose gel electrophoresis were carried out
following standard procedures [33] or according to the
protocols provided by the respective manufacturer’s
(Qiagen, Hilden, Germany; Fermentas GmbH, St Leon-
Rot, Germany; Bangalore Genei P. Ltd., Bangalore, India).
Protein estimation, native and SDS ⁄ PAGE, staining of
polyacrylamide gel and western blotting were performed as
described previously [13,34]. DNA from /11 phage particles
was isolated as described previously [32]. Sequencing of all
/11 DNA inserts (amplified by PCR) were performed at
the DNA sequencing facility at the University of Delhi,
South Campus (Delhi, India). Sequencing of the N-terminal
ends of all protein fragments was performed using a protein
sequencer (Applied Biosystems, Foster City, CA, USA)
according to the manufacturer’s protocol.
Overexpression and purification of /11 repressor
/11 CI was overexpressed in E. coli BL21 (DE3)
(pSAU1220) and purified by Ni-NTA column chromatogra-
phy, as described previously [15]. To further purify the /11
hydryl (-SH) groups in CI in buffer C was determined by
DTNB according to a standard procedure [35]. MALDI-
TOF analysis of protein fragments was carried out using
an Autoflex II TOF ⁄ TOF instrument (Bruker Daltonics,
Ettlingen, Germany) according to the manufacturer’s
protocol.
Homology modeling
Amino acid residues 1–118 and 119–239 of native /11 CI
were used to develop 3D model structures of the NTD
and CTD of this protein by the First Approach Mode of
swiss-model (http://ExPasy.org). Although the crystal
structure of E. coli LexA CTD (Protein Databank code:
1jhc) was utilized as a template for developing the model
structure of the CTD of /11 CI, the X-ray structure of a
putative DNA binding protein (Protein Databank code:
3bs3) of Bacteroides fragilis was used as a template for
generating the model structure of NTD of /11 CI. Using
the coordinates of the resulting model structures, molecu-
lar visualization, superimposition of the structures, surface
structure determination and drawing of Ramachandran
plots were carried out by the swiss-pdb viewer (http://
ExPasy.org).
Gel shift assay
Equilibrium binding of CI to various 0.1 nm
32
P-labeled
DNAs (harboring one ⁄ two /11 operators or no operator)
was investigated by the standard gel shift assay, as
described previously [15]. The 154 bp O1O2 DNA fragment
Characterization of /11 repressor T. Ganguly et al.
procedures [33]. Briefly, to label the bottom strand of O
DNA with
32
P, pSAU1201 was treated successively with
EcoRI, Klenow polymerase and [a-
32
P] dATP, and BamHI.
Finally, the bottom strand labeled O DNA was purified
from an agarose gel. To label the top strand of O DNA
with
32
P, the oligonucleotide pHC2 (Table 1) was
end-labeled with [c-
32
P] ATP followed by the PCR amplifi-
cation of O DNA by Taq polymerase using pSAU1201
DNA or /11 DNA as a template and the oligonucleotides
pHC1 and labeled pHC2 as primers. The resulting DNA
fragment was purified from an agarose gel.
DNase I footprinting was performed according to a stan-
dard procedure [5] with some modifications. Briefly, 60 nm
labeled DNA fragment ( 5000 c.p.m.) was incubated with
varying concentrations of CI in 50 lL buffer C for 20 min
on ice. Every reaction mixture was made 1 mm with MgCl
2
and treated with 0.15 units of DNase I for 4 min at room
temperature followed by termination of the reactions by the
addition of 90 lL of Stop solution [200 mm NaCl, 80 m m
EDTA (pH 8.0), 1% SDS, 0.03% glycogen]. Cleaved DNA
fragments, prepared by sequential passage of each reaction
Acknowledgements
This work was supported by the financial assistance
from the Department of Atomic Energy (Government
of India, Mumbai, India) to S. Sau. The authors thank
Drs P. Parrack, R. Chattopadhyaya and N. C. Mandal
for critically reading, correcting and modifying the
manuscript. The authors are extremely grateful to
Table 1. Details of the oligonucleotides used.
Name Sequence (5¢-to3¢) Purpose
pHC1 GGATCCTAAATCTTCTTGAGTAC Synthesis of O and
O1O2 DNAs
pHC2 GAATTCTTGGTTCTATAGTATCTG Synthesis of O DNA
PCR11 GACTCAAGTACACGTATCGTGTATA
GTAGGTTTA
Synthesis of O1DNA
PCR21 AAACCTACTATACACGATACGTGTA
CTTGAGTCA
Synthesis of O1 DNA
IIa ATTCAACAAAAAAATACACGAAAAG
CAAACTTTTATGTTGACTCAAGTA
Synthesis of O2 and
O1O2 DNAs
IIb TACTTGAGTCAACATAAAAGTTTGC
TTTTCGTGTATTTTTTTGTTGAAT
Synthesis of O2 DNA
PCI51 GAATTCTCGCTAATTCTTTTTTATC Synthesis of O3 DNA
IIId TTTTTTTGTTGAATACCAAAAATAA
TTGGGTTATACTATAG
Synthesis of O3 DNA
CSP4 CATGCCATGGATGAATAACGGTACAG Synthesis of S. aureus
Microbiol Rev 17, 121–126.
4 Kimsey HH & Waldor MK (2004) The CTX phi repres-
sor RstR binds DNA cooperatively to form tetrameric
repressor-operator complexes. J Biol Chem 279, 2640–
2647.
5 Koudelka AP, Hufnagel LA & Koudelka GB (2004)
Purification and characterization of the repressor of the
shiga toxin-encoding bacteriophage 933W: DNA bind-
ing, gene regulation, and autocleavage. J Bacteriol 186,
7659–7669.
6 Carlson NG & Little JW (1993) Highly cooperative
DNA binding by the coliphage HK022 repressor. J Mol
Biol 230, 1108–1130.
7 Ogawa T & Ogawa H (1988) Organization of the early
region of bacteriophage 80. J Mol Biol 202, 537–550.
8 Ptashne M (ed.) (1992) A Genetic Switch Gene Control
and Phage k. Harvard University, Cell Press & Black-
well Scientific Publications, Cambridge, MA.
9 Dodd IB, Shearwin KE & Egan JB (2005) Revisited
gene regulation in bacteriophage Lambda. Curr Opin
Genet Dev 15, 145–152.
10 Rousseau P, Betermier M, Chandler M & Alazard R
(1996) Interactions between the repressor and the early
operator region of bacteriophage Mu. J Biol Chem 271,
9739–9745.
11 van Kaer L, van Montagu M & Dhaese P (1989) Purifi-
cation and in vitro DNA-binding specificity of the
Bacillus subtilis phage phi 105 repressor. J Biol Chem
264, 14784–14791.
12 Susskind MM & Youderian P (1983) Bacteriophage P22
(2001) Crystal structure of LexA: a conformational
switch for regulation of self-cleavage. Cell 106, 585–594.
19 Bell CE, Frescura P, Hochschild A & Lewis M (2000)
Crystal structure of the lambda repressor C-terminal
domain provides a model for cooperative operator
binding. Cell 101, 801–811.
20 Stayrook S, Jaru-Ampornpan P, Ni J, Hochschild A &
Lewis M (2008) Crystal structure of the lambda repres-
sor and a model for pairwise cooperative operator bind-
ing. Nature 452, 1022–1025.
21 Bohm G, Muhr R & Jaenicke R (1992) Quantitative
analysis of protein far UV circular dichroism spectra by
neural networks. Protein Eng 5, 191–195.
22 Hecht MH, Sturtevant JM & Sauer RT (1984) Effect of
single amino acid replacements on the thermal stability
of the NH2-terminal domain of phage lambda repres-
sor. Proc Natl Acad Sci USA 81, 5685–5689.
23 Stearman RS, Frankel AD, Freire E, Liu BS & Pabo
CO (1988) Combining thermostable mutations increases
the stability of lambda repressor. Biochemistry 27,
7571–7574.
Characterization of /11 repressor T. Ganguly et al.
1984 FEBS Journal 276 (2009) 1975–1985 ª 2009 The Authors Journal compilation ª 2009 FEBS
24 Watanabe K, Chishiro K, Kitamura K & Suzuki Y
(1991) Proline residues responsible for thermostability
occur with high frequency in the loop regions of an
extremely thermostable oligo-1,6-glucosidase from
Bacillus thermoglucosidasius KP1006. J Biol Chem 266,
24287–24294.
25 Chattopadhyaya R & Ghosh KA (2003) A comparative
31 Novick RP (1990) The Staphylococcus as a Molecular
Genetic System. In Molecular Biology of the Staphylo-
cocci (Novick RP, ed.), pp 1–37. VCH Publishers, Inc.,
New York, NY.
32 Lee CY & Iandolo JJ (1988) Structural analysis of
staphylococcal bacteriophage phi 11 attachment sites.
J Bacteriol 170, 2409–2411.
33 Sambrook J & Russell DW (2001) Molecular Cloning:
A Laboratory Manual. 3rd ed., Cold Spring Harbor
Laboratory Press, CSH, New York, NY.
34 Ausubel FM, Brent R, Kingston RE, Moore DD,
Seidman JG, Smith JA & Struhl K (1998) Current
Protocols in Molecular Biology. John Wiley & Sons,
New York, NY.
35 Saha RP, Basu G & Chakrabarti P (2006) Cloning,
expression, purification, and characterization of Vibrio
cholerae transcriptional activator, HlyU. Protein Expr
Purif 48, 118–125.
36 Chanda PK, Mondal R, Sau K & Sau S (2008) Anti-
biotics, arsenate and H
2
O
2
induce the promoter of
Staphylococcus aureus cspC gene more strongly than
cold. J Basic Microbiol, doi: 10.1002/jobm.200800065.
37 Monini P, Grossman SR, Pepinsky B, Androphy EJ &
Laimins LA (1991) Cooperative binding of the E2 pro-
tein of bovine papillomavirus to adjacent E2-responsive
sequences. J Virol 65, 2124–2130.