SAF-3, a novel splice variant of the SAF-1/MAZ/Pur-1
family, is expressed during inflammation
Alpana Ray
1
, Srijita Dhar
1
, Arvind Shakya
1
, Papiya Ray
1
, Yasunori Okada
2
and Bimal K. Ray
1
1 Department of Veterinary Pathobiology, University of Missouri, Columbia, MO, USA
2 Department of Pathology, School of Medicine, Keio University, Tokyo, Japan
Introduction
Transcription factors play a central role in regulating
cell growth and development as well as in cellular
maintenance as a result of their indispensable role in
synthesizing mRNA. Dysregulation of transcription
factor activity leads to alteration in target gene expres-
sion patterns, which is one of the most important
causes of disease development and progression. Exten-
sive studies on the characterization of transcription
factors have indicated that, in general, transcription
factors exist as a family of structurally related proteins,
containing conserved and unique domains. The family
members can perform similar tasks due to the con-
served domains but may be functionally specific due to
the unique domains. The various members of the

cDNA library produced from IL-1b-induced cells, originates from a previ-
ously unknown first coding exon, and thereby contains a unique N-termi-
nal domain but shares the same six zinc finger DNA-binding domains as
present in SAF-1. In addition, a negatively functioning domain present at
the N-terminus of SAF-1 and SAF-2 is spliced out in SAF-3. The expres-
sion of SAF-3 is very low in normal tissues and in cells grown under
normal conditions. However, RT-PCR analysis of mRNAs from cytokine
and growth factor-induced cells as well of mRNAs isolated from several
diseased tissues revealed abundant expression of SAF-3. The transactiva-
tion potential of SAF-3 is much greater than that of the predominantly
expressed splice variant SAF-1. These findings show that transcriptional
regulation of downstream inflammation-responsive genes by SAF/MAZ/
Pur-1 is likely to be more complex than previously assumed. In addition,
we show that SAF-3 expression initiates from an upstream novel promoter.
This is the first report of the existence of multiple promoters regulating
expression of the SAF/MAZ/Pur-1 family of proteins.
Abbreviations
CAT, chloramphenicol acetyl transferase; GAPDH, glyceraldehyde-3-phosphate dehydrogenase; MAZ, myc-associated zinc finger protein;
MMP, matrix metalloproteinase; OA, osteoarthritis; Pur-1, purine binding factor-1; RA, rheumatoid arthritis; SAF-1, serum amyloid A
activating factor; VEGF, vascular endothelial growth factor.
4276 FEBS Journal 276 (2009) 4276–4286 ª 2009 The Authors Journal compilation ª 2009 FEBS
family are often generated from a single gene by alter-
native splicing, which is recognized as an efficient
means of increasing the diversity of proteins.
Serum amyloid A activating factor 1 (SAF-1) is the
first identified member of a transcription factor family
containing multiple Cys2His2-type zinc finger proteins
[1]. The human and mouse orthologs of SAF-1 are
known as myc-associated zinc finger protein (MAZ) [2]
and purine binding factor-1 (Pur-1) [3], respectively.

tive regulator of SAF-1 function under normal condi-
tions [23]. During inflammation, SAF-2 expression is
down-regulated, which alleviates the repression of
SAF-1 activity and further promotes SAF-1-mediated
transactivation of the target genes [23]. In this paper,
we present evidence for a third member of SAF family,
which is also transcribed from the same gene but origi-
nates from an upstream novel start site and contains
an entirely different N-terminus. Expression of SAF-3
is restricted to inflammatory conditions. Further, we
present evidence that SAF-3 is much more transcrip-
tionally active than SAF-1. These results shed light on
the relevance of the generation of multiple distinct
functional SAF isoforms, and imply the existence of
combinatorial mechanisms that allow fine regulation
by SAF-regulated genes.
Results
Identification and characterization of a novel SAF
isoform
Screening of an IL-1b-induced human HTB-94 chon-
drocyte cell cDNA library identified a novel human
SAF-1/MAZ/Pur-1 isoform that contains unique
N-terminal sequences (Fig. 1). This clone, with an
open reading frame of 455 amino acids, was designated
SAF-3 (GenBank accession number FJ532357), with
SAF-1/MAZ/Pur-1 being the originally identified iso-
form [1–3]. Comparison of amino acid sequences indi-
cated that the N-terminal region of SAF-3 is different
from that of SAF-1, after which both cDNAs contain
identical sequences. The previously isolated SAF-2 iso-

cDNA contains a full-length 5¢ UTR. A
32
P-end-
labeled, 18-base antisense oligonucleotide primer was
A. Ray et al. Transcription factor SAF-3 is expressed during inflammation
FEBS Journal 276 (2009) 4276–4286 ª 2009 The Authors Journal compilation ª 2009 FEBS 4277
Fig. 1. Analysis of a structurally altered
form of SAF. The nucleic acid and predicted
amino acid sequences of the cDNA encod-
ing SAF-3 are shown. The initiator ATG
codon and stop codon are indicated.
Transcription factor SAF-3 is expressed during inflammation A. Ray et al.
4278 FEBS Journal 276 (2009) 4276–4286 ª 2009 The Authors Journal compilation ª 2009 FEBS
utilized for the primer extension reaction, and
indicated several possible transcription start sites for
SAF-3 mRNA (Fig. 2E, lane 2). However, the esti-
mated length of the major primer extension product
corresponded well with the sequence of cloned SAF-3,
suggesting that this cDNA possibly contains a full-
length 5¢ UTR. The two faint but longer primer-
extended products that were visible in Fig. 2E, lane 2,
probably arise from other transcription start sites, and
are minor transcription products. Nested RT-PCR
analysis was performed for further verification of the
existence of novel exon 1A in SAF-3. A product of the
A
B
E
F
G

Intron
size
(nt) 3¢ splice acceptor
1A 75 ATCTTCCAGgtaacaac 625 cacctcagGGTCACGCC
1C 87 CCATTCCAGgtgagtag 84 ctccgcagGCCGCGCCG
2 851 CTTCTCCCGgtgtgcac 403 gtccccagGCCGGATCA
364AATGTGAGgtaggaag 277 ctcctcagAAATGTGAG
4 172 CAACAAAGgtacatgc 1335 ctgtgcagGTACTGGTG
5 1028
A. Ray et al. Transcription factor SAF-3 is expressed during inflammation
FEBS Journal 276 (2009) 4276–4286 ª 2009 The Authors Journal compilation ª 2009 FEBS 4279
right size was amplified from mRNAs of IL-1b-
induced HTB-94 cells using an upstream primer corre-
sponding to the 5¢ untranslated sequences of SAF-3
and a downstream primer corresponding to the
sequences at exon 2 (Fig. 2F, lane 1). The identity of
the PCR-amplified product was verified by DNA
sequence analysis. The same downstream primer at
exon 2, together with an upstream primer correspond-
ing to the SAF-1 sequence at exon 1B, produced an
SAF-1-specific PCR product (Fig. 2F, lane 2). The
translation product of SAF-3 cDNA was determined
by cloning SAF-3 cDNA in a bacterial expression vec-
tor (Fig. 2G). In line with the cDNA size, bacterially
expressed SAF-3 protein migrates slightly faster than
bacterially expressed SAF-1 protein in the same vector
(Fig. 2G, compare lanes 3 and 2). We performed a
coupled in vitro transcription and translation reaction
to further determine whether SAF-3 is indeed initiated
from the first ATG codon. The SAF-3 protein trans-

cells. RT-PCR of RNA isolated from untreated and
IL-1b-treated HTB-94 cells showed expression of a
detectable level of SAF-3 only upon cytokine induction
A
B C D
E
Fig. 3. Cytokine or growth factor treatment stimulates expression of SAF-3. (A) Northern analysis of an RNA blot (Clontech) containing 1.0 lg
of poly(A)
+
RNA per lane from various tissues as indicated. The blot was hybridized using a
32
P-labeled oligonucleotide probe containing
unique exon 1A sequences of SAF-3 mRNA. (B) The same blot was stripped and re-hybridized with a full-length 1.4 kb
32
P-labeled SAF-1
cDNA probe. (C) SAF-1 (lane 2) and SAF-3 (lane 3) RNAs were in vitro transcribed from corresponding cDNA plasmids by T7 RNA polymerase.
Reaction products were fractionated in a 1% agarose gel, transferred to nylon membrane, and hybridized with a
32
P-labeled oligonucleotide
probe containing unique exon 1A sequences of SAF-3 mRNA. Lane 1 contains HindIII-digested kcI857 DNA. (D) HTB-94 and Saos-2 cells
were treated with or without IL-1b (500 UÆmL
)1
) or TGFb (5 ngÆmL
)1
), as indicated. Total RNA isolated from these cells was subjected to
reverse transcription followed by nested PCR amplification to monitor SAF-3 expression. The same sets of RNAs were also used to monitor
MMP-9 and GAPDH expression, as indicated. The PCR products were separated in a 1.5% agarose gel and visualized by ethidium bromide
staining. (E) Western blotting with SAF-3-specific antibody. One microgram each of purified bacterially expressed SAF-1 protein (lane 1) and
SAF-3 protein (lane 2) and 50.0 lg each of uninduced (lane 3) and IL-1b-induced (lane 4) HTB-94 cell extracts were fractionated by 11% SDS–
PAGE, transferred onto membrane and Western blotted with anti-SAF-3 serum. The arrow indicates SAF-3 protein in IL-1b-induced cells.

(Fig. 4, lanes 3–6) and RA synovial (Fig. 4, lanes 7–9)
tissues, but very little to no SAF-3 mRNA expression
was detected in normal synovium (Fig. 4, lanes 1 and
2). SAF-1 expression was detected in normal tissues
and was slightly elevated in both disease conditions.
This result is consistent with previous findings indicat-
ing that the main mode of activation of SAF-1 is by
post-translational modification, including phosphoryla-
tion [13, 16, 17]. Together, these results indicated that
SAF-3 expression is very low and highly regulated
under normal conditions, but increases in response to
pathogenic signals and cytokine or growth factor
stimulation.
SAF-3 is a superior transcriptional activator
SAF-3 contains six zinc finger motifs, and should have
the ability to interact with DNA at a similar level to
SAF-1 [26]. However, because it contains a different
N-terminus, the transactivation potential of SAF-3
may be different, and it may thereby regulate expres-
sion of downstream genes at a different level. To
determine the functional significance of SAF-3, we
compared its transactivation potential with that of
SAF-1. The SAF-3 expression plasmid transactivated
expression of the SAF-3X-CAT reporter at a much
higher level than the same amount of SAF-1 expression
plasmid DNA (Fig. 5A). To rule out the possibility
that SAF-1 and SAF-3 proteins were not expressed at
the same level, we performed a Western blot assay
using an anti-His tag IgG and representative trans-
fected cells (Fig. 5B). This experiment showed no

and GAPDH-specific primers, as indicated. GAPDH expression was
used as an internal control.
A. Ray et al. Transcription factor SAF-3 is expressed during inflammation
FEBS Journal 276 (2009) 4276–4286 ª 2009 The Authors Journal compilation ª 2009 FEBS 4281
albeit variable, compared to cells transfected with the
promoterless pBLCAT3 vector (Fig. 6). These results
clearly indicate that the DNA sequences between
)2000 and )351 and )351 and +200 contain neces-
sary elements that can promote transcription. We con-
clude from these results that the human SAF-1 gene
has at least two promoters.
Discussion
In this paper, we describe a novel splice variant of
SAF-1/MAZ/Pur-1 family of transcription factors that
may be involved in regulating inflammation-induced
expression of various SAF targets associated with
pathogenic conditions. In addition, we provide the first
evidence of the existence of two promoters in the
human SAF-1/MAZ/Pur-1 gene that permit transcrip-
tion of multiple mRNAs with different N-termini. The
novel SAF-3 splice variant reported here is transcribed
from the upstream promoter. SAF-3 is predominantly
expressed in cytokine- and growth factor-treated cells
and in diseased tissues, but is barely detectable under
normal conditions.
A
B
C
Fig. 5. Transactivation potential of SAF-3. (A) HTB-94 cells were
co-transfected with SAF3X-CAT2 reporter plasmid (0.5 lg) and

[27–29]. This versatile mode of gene regulation is uti-
lized during development, sex determination, hormonal
regulation and apoptosis. Deletion or inclusion of an
exon during splicing can generate a family of transcrip-
tion factors that may have subtle or dramatically dif-
ferent properties. Due to such changes in specificity
and/or binding strength, one member can act as a neg-
ative regulator of another member. In the SAF family
of Cys
2
/His
2
-type zinc transcription factors, the three
members that have been identified so far are generated
from a single gene by alternative splicing. SAF-1 and
SAF-2 mRNAs initiate from the same start site
and thereby have identical N-termini but different
C-termini due to insertion of an exon in SAF-2 [23].
The SAF-3 mRNA is transcribed from an upstream
promoter and contains a totally different N-terminus.
In addition, a portion of the first exon constituting the
N-terminus of SAF-1/SAF-2 mRNA is deleted in
SAF-3 mRNA (Figs 1 and 2). In previous studies, this
region of SAF-1/SAF-2 was shown to contain a nega-
tively functioning module [26]. The SAF-2 isoform
activates SAF-1 under inflammatory conditions in a
unique fashion [23]. Under normal conditions, SAF-2
negatively regulates SAF-1 transactivation, but, as
SAF-2 is down-regulated under various inflammatory
conditions, the repression of SAF-1 activity is relieved,

[33], and ever since the clear demonstration of a causal
relationship between hypermethylation of the promoter
of tumor suppressor genes and the development of
cancer, it has been believed that transcription of many
genes is repressed via DNA methylation [34]. It
remains to be investigated whether transcription from
the upstream SAF promoter, i.e. expression of SAF-3
mRNA, is regulated via DNA methylation.
In conclusion, we show that the human SAF-1/
MAZ/Pur-1 gene has two promoters, which are
utilized to produce multiple mRNAs with unique prop-
erties. A specific increase in the expression level of
SAF-3 transcript transcribed from the upstream pro-
moter may determine the level of SAF protein during
inflammation and pathogenic conditions. Further anal-
yses of the factors that modulate transcriptional activ-
ity of the upstream SAF promoter are necessary to
clarify the mechanisms regulating increased expression
of SAF-3 during inflammatory conditions.
Experimental procedures
Isolation, cloning and sequencing of the SAF-3
splice variant
A kgt-11 cDNA library was prepared using mRNAs iso-
lated from IL-1b-induced human HTB-94 cells. The library
was screened using an SAF-1 cDNA probe. The DNA
inserts from the selected clones were sub-cloned in pTZ19U
and sequenced. One of these cDNA clones contained the
SAF-3 sequence. The promoter region of SAF-1/SAF-2/
SAF-3 was isolated by screening a human genomic DNA
library in kEMBL3 (Clontech Laboratories Inc., Mountain

DNA fragment of human VEGF gene into the pBLCAT3
vector as described previously [5]. Expression plasmids
pcDHis-SAF-3 and pcDHis-SAF-1 were constructed by
ligating full-length SAF-3 or SAF-1 cDNA into the
pCDNA3.1-His vector (Invitrogen, Carlsbad, CA, USA).
The ()2000/+200)SAF-CAT, ()2000/)351)SAF-CAT and
()351/+200)SAF-CAT plasmids were prepared by PCR
amplification of the respective DNA fragments of the pro-
moter region of human SAF gene followed by ligation into
the pBLCAT3 plasmid vector.
Preparation of SAF-1 and SAF-3 proteins
For bacterially expressed SAF-1 and SAF-3 proteins, the
corresponding cDNAs were subcloned into the pRSET
vector (Invitrogen). Proteins expressed from these con-
structs were purified by nickel–agarose column chroma-
tography (Invitrogen) according to the manufacturer’s
protocol.
Isolation of RNA and RT-PCR
Total RNA was isolated from untreated HTB-94 cells and
from HTB-94 and Saos-2 cells treated with IL-1b
(500 UÆmL
)1
) and TGF-b (5 ngÆmL
)1
), respectively, using
the guanidinium thiocyanate method [36]. Total RNA was
isolated from synovial tissue of OA and RA patients as
described previously [37]. Briefly, arthritic synovial tissue
was obtained from patients undergoing total knee joint or
hip replacement. Synovial tissues were prepared from seven

CTG-3¢ (forward) and 5¢-GAGAACCGGGAGCAAGTC
CAC-3¢ (reverse), and the amplification product was
271 bp. The primers for MMP-9 were 5¢-GGCTCTCCAA
GAAGCTTTTCTC-3¢ (forward; present in exon 10) and
5¢-CATAGCTCACGTAGCCCACTTGG-3¢ (reverse; pres-
ent in exon 13), and the amplification product was 378 bp.
The primers for GAPDH were 5¢-TGCACCACCAACTG
CTTAG-3¢ (forward) and 5¢-AGAGGCAGGGATGATGT
TC-3¢ (reverse), and the amplification product was 177 bp.
Northern blot analysis
A multiple-tissue Northern blot (Clontech Laboratories
Inc.) was hybridized using a
32
P-labeled oligonucleotide
probe that contained the unique region of SAF-3. The
sequence of the SAF-3 specific oligonucleotide probe is
5¢-CCAGGGTGAGCGCGAGCCACCTCCCTCCCTCCC
TCCGCCATGGATCCCAGCAACTGGAGCAGCTTCAT
CTTCCAG-3¢. After stripping off the probe, the same
membrane was re-hybridized with a
32
P-labeled SAF-1
cDNA probe containing the entire coding region (approxi-
mately 1.4 kb).
Primer extension analysis
For primer extension analysis, 0.5 lg of poly(A)
+
RNA
from IL-1b-induced HTB-94 cells was hybridized with a 5¢-
end

12% polyacrylamide/urea sequencing gel.
Preparation of SAF-3 and SAF-1 RNA by in vitro
transcription
To prepare SAF-3 and SAF-1 RNA transcripts, full-length
SAF-3 and SAF-1 cDNAs cloned into pTZ19U vector were
subjected to in vitro transcription using T7 RNA polymer-
ase and a commercial Riboprobe System T7 kit (Promega)
according to the manufacturer’s protocol. The products
were fractionated in a 1% agarose gel, transferred to nylon
membrane and hybridized with radioactive SAF-3-specific
oligonucleotide probe.
In vitro transcription and translation of SAF-3
protein
Full-length SAF-3 cDNA cloned into pTZ19U vector was
subjected to in vitro transcription and translation using a
T
N
T T7 coupled reticulocyte lysate system kit (Promega)
according tot the manufacturer’s protocol. In vitro tran-
scription of SAF-3 mRNA was performed by using T7
RNA polymerase, and transcribed SAF-3 mRNA was fur-
ther in vitro translated and
35
S-labeled. The control reaction
contained no plasmid DNA. The reaction products were
fractionated by 11% SDS–PAGE and visualized by auto-
radiography.
Western blot analysis
pcDNA3-His, pcDSAF-1 and pCDSAF-3 plasmid-trans-
fected cells were lysed in 50 mm Tris/HCl pH 7.5, 100 mm

gene sequences regulating transcriptional initiation
and termination. Proc Natl Acad Sci U S A 89,
7452–7456.
3 Kennedy GC & Rutter WJ (1992) Pur-1, a zinc-finger
protein that binds to purine-rich sequences, transacti-
vates an insulin promoter in heterologous cells. Proc
Natl Acad Sci U S A 89, 11498–11502.
4 Ray A & Ray BK (1996) A novel cis-acting element is
essential for cytokine-mediated transcriptional induction
of the serum amyloid A gene in nonhepatic cells. Mol
Cell Biol 16, 1584–1594.
5 Ray BK, Shakya A & Ray A (2007) Vascular endothe-
lial growth factor expression in arthritic joint is regu-
lated by SAF-1 transcription factor. J Immunol 178,
1774–1782.
6 Ray A, Shakya A, Kumar D & Ray BK (2004) Overex-
pression of serum amyloid A activating factor 1 inhibits
cell proliferation by the induction of cyclin-dependent
protein kinase inhibitor p21WAF-1/Cip-1/Sdi-1 expres-
sion. J Immunol 172, 5006–5015.
7 Ray A, Kuroki K, Cook JL, Bal BS, Kenter K, Aust G
& Ray BK (2003) Induction of matrix metalloproteinase
1 gene expression is regulated by inflammation-respon-
sive transcription factor SAF-1 in osteoarthritis.
Arthritis Rheum 48, 134–145.
8 Ray BK, Shakya A, Turk JR, Apte SS & Ray A (2004)
Induction of the MMP-14 gene in macrophages of the
atherosclerotic plaque: role of SAF-1 in the induction
process. Circ Res 95, 1082–1090.
9 Ray A, Shakya A & Ray BK (2005) Inflammation-

amyloid A gene in monocyte/macrophage cells. DNA
Cell Biol 18, 65–73.
16 Ray A, Yu GY & Ray BK (2002) Cytokine-responsive
induction of SAF-1 activity is mediated by a mitogen-
activated protein kinase signaling pathway. Mol Cell
Biol 22, 1027–1035.
17 Ray A, Ray P, Guthrie N, Shakya A, Kumar D &
Ray BK (2003) Protein kinase A signaling pathway regu-
lates transcriptional activity of SAF-1 by unmasking its
DNA-binding domains. J Biol Chem 278, 22586–22595.
18 Kovacevic A, Hammer A, Stadelmeyer E, Windischho-
fer W, Sundl M, Ray A, Schweighofer N, Friedl G,
Windhager R, Sattler W et al. (2008) Expression of
serum amyloid A transcripts in human bone tissues,
differentiated osteoblast-like stem cells and human
osteosarcoma cell lines. J Cell Biochem 103, 994–1004.
19 Dudas J, Mansuroglu T, Moriconi F, Haller F, Wilting
J, Lorf T, Fuzesi L & Ramadori G (2008) Altered regu-
lation of Prox1 gene-expression in liver tumors. BMC
Cancer 8, 92–106.
20 Daheron L, Salmeron S, Patri S, Brizard A, Guilhot F,
Chomel JC & Kitzis A (1998) Identification of several
genes differentially expressed during progression of
chronic myelogenous leukemia. Leukemia 12, 326–332.
21 Greiner J, Ringhoffer M, Simikopinko O, Szmara-
gowska A, Huebsch S, Maurer U, Bergmann L &
Schmitt M (2000) Simultaneous expression of different
immunogenic antigens in acute myeloid leukemia.
Exp Hematol 28, 1413–1422.
22 Himeda CL, Ranish JA & Hauschka SD (2008) Quanti-

repression by the methyl-CpG-binding protein MeCP2
involves a histone deacetylase complex. Nature 393,
386–389.
31 Jones PL, Veenstra GJ, Wade PA, Vermaak D, Kass
SU, Landsberger N, Strouboulis J & Wolffe AP (1998)
Methylated DNA and MeCP2 recruit histone deacety-
lase to repress transcription. Nat Genet 19, 187–191.
32 Bird A (2002) DNA methylation patterns and epigenetic
memory. Genes Dev 16, 6–21.
33 Miranda TB & Jones PA (2007) DNA methylation: the
nuts and bolts of repression. J Cell Physiol 213,
384–390.
34 Baylin SB (2002) Mechanisms underlying epigenetically
mediated gene silencing in cancer. Semin Cancer Biol
12, 331–337.
35 Sambrook J & Russell DW (2001) Molecular Cloning:
A Laboratory Manual, 3rd edn. Cold Spring Harbor
Laboratory Press, Cold Spring Harbor, NY.
36 Chomczynski P & Sacchi N (1987) Single-step method
of RNA isolation by acid guanidinium thiocyanate–phe-
nol–chloroform extraction. Anal Biochem 162, 156–159.
37 Imai K, Morikawa M, D’Armiento J, Matsumoto H,
Komiya K & Okada Y (2006) Differential expression of
WNTs and FRPs in the synovium of rheumatoid arthri-
tis and osteoarthritis. Biochem Biophys Res Commun
345, 1615–1620.
Transcription factor SAF-3 is expressed during inflammation A. Ray et al.
4286 FEBS Journal 276 (2009) 4276–4286 ª 2009 The Authors Journal compilation ª 2009 FEBS