Role of DptE and DptF in the lipidation reaction
of daptomycin
Melanie Wittmann, Uwe Linne, Verena Pohlmann and Mohamed A. Marahiel
Department of Chemistry ⁄ Biochemistry, Philipps-University Marburg, Germany
Daptomycin is a clinically important semi-synthetic
derivative of the A21978C branched cyclic lipopeptide
antibiotics produced by Streptomyces roseosporus [1] .
Acidic lipopeptide antibiotics present a new class of
therapeutic agents that includes compounds such as
calcium dependent antibiotic (CDA) [2], A54145 [3,4]
and friulimicin [5,6] with a unique mechanism of
action. Daptomycin binds to Gram-positive cell
membranes via its lipid moiety, followed by calcium-
dependent insertion and oligomerization. Subsequently,
oligomers form ion channels that disrupt the bacterial
membrane potential, leading to rapid cell death [7,8].
Daptomycin comprises a 13-amino acid peptide core
coupled to a fatty acid moiety (Fig. 1). The peptide
core is assembled nonribosomally by dptA and dptBC.
The thioesterase DptD of the daptomycin biosynthetic
gene cluster catalyses the cyclization reaction between
the hydroxyl group of Thr4 and the C-terminal
Kyn13, resulting in a ten-membered ring [8]. More-
over, several ORFs localized within the gene cluster
are associated with the biosynthesis of non-proteino-
genic amino acids and incorporation of the fatty acid
moiety [1].
All acidic lipopeptides (except CDA) produced
in vivo show some flexibility with respect to the length
and branching of their N-terminally attached fatty acid
groups (Fig. 1). The activity of lipopeptide antibiotics

genes, dptE and dptF, localized upstream of the daptomycin nonribosomal
peptide synthetase genes, are thought to be involved in the lipidation of
daptomycin. Here we describe the cloning, heterologous expression, purifi-
cation and biochemical characterization of the enzymes encoded by these
genes. DptE was proven to preferentially activate branched mid- to
long-chain fatty acids under ATP consumption, and these fatty acids are
subsequently transferred onto DptF, the cognate acyl carrier protein. Addi-
tionally, we demonstrate that lipidation of DptF by DptE in trans is based
on specific protein–protein interactions, as DptF is favored over other acyl
carrier proteins. Study of DptE and DptF may provide useful insights into
the lipidation mechanism, and these enzymes may be used to generate
novel daptomycin derivatives with altered fatty acids.
Abbreviations
CDA, calcium dependent antibiotic; PKS, polyketide synthase.
FEBS Journal 275 (2008) 5343–5354 ª 2008 The Authors Journal compilation ª 2008 FEBS 5343
condensation (C
III
) domains that are thought to cata-
lyse N-acylation of the first amino acid in the peptide
chain [13]. However, the fatty acid moiety must be
activated prior to being incorporated into the
product. Two classes of enzymes are known to
catalyse such reactions. One class, acyl CoASH
synthetases, recognize and activate fatty acids as acyl
adenylates (acyl AMPs), and subsequently couple
them to coenzyme A (CoASH). The second class,
fatty acyl ACP ligases, activate and transfer fatty
acids from acyl AMP to cognate acyl carrier proteins
(ACPs) [14,15].
The genes dptE and dptF are localized immediately

with the epoxidized hexanoyl moiety exclusively.
Lipidation of daptomycin M. Wittmann et al.
5344 FEBS Journal 275 (2008) 5343–5354 ª 2008 The Authors Journal compilation ª 2008 FEBS
DptE was cloned into the pBAD102 ⁄ D-TOPO
Ò
vector and overexpressed in Escherichia coli
BL21(DE3). The C-terminally His6-tagged and N-ter-
minally thioredoxin-fused protein was purified, yielding
4.4 mgÆL
)1
of culture. The identity of the protein was
confirmed by SDS–PAGE (Fig. 3) and mass spectro-
metry (Table 1). An initial fatty acid-dependent
ATP ⁄ PP
i
exchange assay according to functionally
related adenylation domains of NRPSs showed no
activity (data not shown). To determine whether
CoASH is the physiological substrate of DptE and
required for enzyme activity, we determined the
activity of DptE with ATP, MgCl
2
and CoASH under
various conditions. However, no acyl CoA was detect-
able by HPLC-MS (data not shown).
As we were not able to detect any in vitro activity of
DptE using ATP ⁄ PP
i
exchange assays, and no lipidation
of CoASH was observed in the presence of fatty acids,

DptBC
DptD
daptomycin
DptF
S
O
decanoyl-S-ACP
7
Mg
2+
AMP
DptE
O
O
7
AMP
Fig. 2. Proposed mechanism for the
lipidation of daptomycin by DptE and DptF.
Decanoic acid is activated by the putative
adenylating enzyme DptE under ATP con-
sumption. The fatty acid is then transferred
onto the acyl carrier protein DptF. The C
domain of DptA is predicted to catalyse the
condensation reaction between the fatty
acid and tryptophan.
kDa
DptE
aDptF
hDptF
aLipD

holo-LipD 11 480.4 11 480.5
apo-AcpK 10 561.5 10 561.0
holo-AcpK 10 901.6 10 901.0
decanoyl-DptF 13 986.9 13 986.9
decanoyl-LipD 11 635.6 11 635.7
decanoyl-AcpK 11 056.7 11 056.8
M. Wittmann et al. Lipidation of daptomycin
FEBS Journal 275 (2008) 5343–5354 ª 2008 The Authors Journal compilation ª 2008 FEBS 5345
and tryptic digestion followed by mass spectrometry.
Subsequently, DptF was incubated with the promiscu-
ous 4¢-phosphopantetheinyl transferase Sfp from Bacil-
lus subtilis and fluoresceinyl CoA [23]. The successful
4¢-phosphopantetheinylation of DptF was monitored by
the in-gel fluorescence of the reaction mixture (Fig. 4).
For subsequent acylation studies, holo-DptF was
produced in the sfp-containing E. coli strain HM0079
[24]. The in vivo modification of DptF by Sfp resulted
in 100% conversion of apo-DptF to holo-DptF as
estimated by tandem fourier transform ion cyclotron
resonance-MS (Fig. 5 and Table 1).
Lipidation of DptF by DptE
Initially, 50 lm holo-DptF was incubated with 500 lm
decanoic acid, 10 mm MgCl
2
,1mm ATP and 1 lm
DptE (Fig. 5). The reaction mixture was quenched with
10% formic acid after 10 min and subjected to HPLC-
ESI-MS analysis (Table 1). DptF was quantitatively
acylated with decanoic acid. Subsequently, we deter-
mined the pH and temperature for maximum forma-

and k
cat
values of DptE for holo-DptF
(with concentrations between 2.5 and 250 lm) were
29.4 lm and 7.4 min
)1
under decanoic acid satura-
tion (500 lm), resulting in a catalytic efficiency of
0.25 min
)1
Ælm
)1
. Addition of CoASH to the reaction
10
15
20
30
Sfp
++––
50
kDa
kDa
apo-DptF
apo-AcpK
SDS-PAGE UV-irradiation at 312 nm
kDa
kDa
apo-DptF
apo-AcpK
+– + –

DptE
-AMP + PPi
+ATP
m/z
Fig. 5. Fourier transform MS spectra of apo-DptF (left), holo-DptF (middle) and decanoic acid-loaded DptF (right).
0
5000
10 000
15 000
20 000
25 000
c.p.m.
Assay -PPi* -DptE -ATP
-MgCl
2
30 000
Fig. 6. ATP ⁄ PP
i
exchange assay of DptE in the presence of apo-
DptF, and control reactions without radioactive labeled PP
i
(PP
i
*),
DptE, ATP or MgCl
2
.
Lipidation of daptomycin M. Wittmann et al.
5346 FEBS Journal 275 (2008) 5343–5354 ª 2008 The Authors Journal compilation ª 2008 FEBS
mixture did not affect the product formation activity

)1
. These
values are in good agreement with those observed for
other systems in which a fatty acyl ACP synthetase
lipidates a cognate holo-ACP in trans [26]. Octanoic
acid, tetradecanoic acid and the 3-hydroxy fatty acid,
which have not been reported as occurring in the
natural compound, were relatively poor substrates,
with K
M
values 2–13-fold higher than those for fatty
acids naturally found in A21987C. Hexanoic acid,
palmitic acid and 15-methylhexadecanoic acid were not
accepted by DptE.
In summary, DptE is capable of transferring a
variety of fatty acids to the cognate ACP DptF in vitro.
The kinetic data presented in this study indicate that
DptE has a general preference for linear fatty acids
with chain lengths between 8 and 14 carbon units,
particularly iso ⁄ anteiso-branched chain fatty acids and
Table 2. Kinetic parameters for steady-state analysis of the DptE-
catalysed lipidation of DptF determined at varying concentrations of
fatty acids or DptF, LipD and AcpK.
Substrate K
M
(lM) k
cat
(min
)1
) k

C16 was not activated.
+ Na
10901.6
holo-AcpK
10 600 10 500 10 700 10 800 10 900 11 000
Relative abundance
m/z
10901.6
holo-AcpK
+ Na
10561.5
apo-AcpK
m/z
10 600 10 700 10 800 10 900 11 000 11 100 11 200 11 300
Relative abundance
-5'-3'-ADP
Sfp
/ CoASH/
Mg
2+
Fig. 7. AcpK expressed in its active holo form in M15 ⁄ pRep4-gsp
cells (HM404). Only approximately 40% of AcpK is expressed in
the holo form (upper). Phosphopantetheinylation of apo-AcpK with
Sfp after expressing in M15 ⁄ pRep4-gsp cells (HM404) (lower).
M. Wittmann et al. Lipidation of daptomycin
FEBS Journal 275 (2008) 5343–5354 ª 2008 The Authors Journal compilation ª 2008 FEBS 5347
decanoic acid, while long chain fatty acids such as
palmitic acid or 15-methylhexadecanoic acid are not
recognized at all. Hydroxylated fatty acids are
accepted, but with lower efficiencies.

)1
. The catalytic efficiency of the
transfer reaction to LipD (0.047 min
)1
Ælm
)1
) was
approximately five times lower than that for DptF
(0.25 min
)1
Ælm
)1
) (Table 2). In conclusion, these
results suggest that there is specific recognition
between DptE and DptF.
Discussion
Daptomycin is a prominent member of the pharmaco-
logically important class of antimicrobial acidic lipo-
peptides. It has been commercialized as CubicinÒ
(Cubist Pharmaceuticals Inc., Lexington, PA, USA)
for the treatment of serious infections caused by
Gram-positive bacteria [27]. Recently, it has been
shown that the activity of these acidic lipopeptides is
significantly influenced by the length and structure of
their fatty acid moieties [9,10]. In the fermentation of
these natural products, some flexibility with respect to
the length and branching of the lipid side chain has
been observed [10]. Complete biochemical characteri-
zation of the lipidation reaction may allow the
engineering of lipopeptides with modified fatty acid

been proposed to be involved in the biosynthesis of a
yet undetermined polyketide. This domain also shows
broad substrate acceptance but with a preference for
long-chain fatty acids, particularly arachidic acid. The
actual substrates for the fatty acid CoASH ⁄ ACP
synthetases will be limited by the availability of fatty
acids in the host organism.
Interestingly, comparison of the k
cat
⁄ K
M
values for
DptE revealed that it is five times more active with the
physiologically relevant ACP DptF than with to LipD
(Table 2), and is inactive with AcpK. Therefore, the
in trans lipidation of DptF appears to be the result of
specific protein–protein communication [29].
Faa1p, which functions by a common ‘ping pong
BI-BI’ mechanism [30–32], showed a K
M
of 18.3 lm
for its cognate ACP. In the case of CpPKS1-AL, the
K
M
for the lipidation of ACP was 3.53 lm. These
findings are in good agreement with those for DptE,
which has a K
M
of 29.4 lm for its cognate ACP.
In microorganisms, various strategies exist for the

are responsible for the subsequent epoxidation of hexa-
noyl S-ACP [37].
Interestingly, in the case of the lipopeptide surfactin,
neither an acyl CoASH ligase-like domain nor an ACP
could be identified within the biosynthetic gene cluster
using bioinformatic tools [38]. Previously, an unknown
40 kDa protein was thought to be the candidate for
lipidation. However, it has been suggested that the
activated 3-hydroxymyristoyl CoA substrate is bio-
synthesized by the primary metabolism. Recently, it
was reported that the acyl CoA substrate is transferred
to the initiation module SrfA-A1. This transfer is
stimulated by the surfactin thioesterase II SrfD [38].
However, the reaction also took place in the absence
of the thioesterase, but with reduced turnover. To
date, no additional enzyme such as an acyltransferase
or an acyl CoASH ligase has been reported to be
involved in the surfactin initiation process.
Another possibility for lipidation of secondary
metabolites could be the interaction of fatty acid
synthase-like enzymes or substrates from the primary
metabolism with NRPSs or PKSs, as shown for afla-
toxin produced by the fungi Asparagillus parasiticus
and A. flavus [39,40]. In this example, the fatty acid
synthase-like enzymes HexA and HexB synthesize
hexanoic acid from acetyl CoA and two units of
malonyl CoA. This hexanoic acid serves as a precursor
for initiation of the PKS of aflatoxin biosynthesis.
As shown here, the acyl ACP ligase DptE of the
daptomycin biosynthetic gene cluster appears to

Miao et al. [1]. In their work, the daptomycin gene
cluster was heterologously expressed in Streptomyces
lividans. Only authentic daptomycin derivatives were
found and no derivatives with common fatty acids
of the S. lividans organism. Studies utilizing deletion
mutants or biochemical studies involving the initia-
tion module of daptomycin synthetase are required
to prove whether DptE and DptF are essential for
lipidation or whether there are additionally alterna-
tive pathways.
In conclusion, DptE was observed to recognize a
variety of fatty acid moieties. After activation of the
fatty acids under ATP consumption, most likely as
fatty acyl AMPs, DptE subsequently catalyses specific
transfer onto the 4¢-phosphopantethein group of DptF.
The observed substrate tolerance for loading a variety
of fatty acids onto the ACP will facilitate future pro-
jects on the manipulation and combinatorial biosyn-
thesis of acidic lipopeptides. Hopefully, the recognition
and efficient transfer of new building blocks can be
achieved using DptE and DptF. This is important, as
the fatty acid moiety has been proven to have a high
impact on the bioactivity and bioselectivity of these
antibiotics [9,10]. It remains to be clarified whether all
of the fatty acids activated by DptE can be incorpo-
rated into the final product or whether there is an
interfering specificity of the C
III
domain of the initia-
tion module.

GGATCCAACCCGCCCGAAGC GGTC-3¢)
and dptF-rev (5¢-ATA
GCGGCCGCGGTGCGGTCGGCC
AACTG-3¢) (underlining indicates artificial BamHI and NotI
restriction sites). The amplified product was purified on a
1.2% agarose gel using a PCR gel extraction kit (Qiagen),
digested with BamHI and NotI, and ligated into the same
sites of the pQTev vector to yield the plasmid pQTev-dptF.
The integrity of the plasmid was confirmed by sequencing.
The resulting plasmid was used to transform E. coli BL21
(DE3) or E. coli HM0079 [24] for gene expression. The cul-
tures were grown in LB medium supplemented with
100 lgÆmL
)1
ampicillin. Cultures were grown at 37 °Ctoan
attenuance at 600 nm of 0.5, and then the temperature was
decreased to 30 °C and gene expression was induced by addi-
tion of 0.1 mm isopropyl thio-b-d-galactoside (IPTG, final
concentration). Cultures were grown for an additional 4 h
and then harvested by centrifugation (4000 g,4°C, 15 min).
Cloning and expression of DptE
The 1795 bp dptE gene was amplified from Strepto-
myces roseosporus NRLL 11379 genomic DNA using high-
fidelity Phusion DNA polymerase (Finnzymes) and primers
dptE-for (5¢-
CACCATGAGTGAGAGCCGCTGTGCCG
G-3¢; underlining indicates the sequence overhang for the
TOPO cloning) and dptE-rev (5¢-CGCGGGGTGCGGA
TGTGGAG-3¢). The amplified product was purified from a
0.8% agarose gel using a PCR gel extraction kit (Qiagen),

recombinant proteins were monitored by SDS–PAGE,
pooled, and dialysed against phosphate buffer with 100 mm
NaCl using HiTrapÔ desalting columns (GE Healthcare Eur-
ope GmbH, Freiburg, Germany). The recombinant proteins
were then concentrated using membrane-based Amicon
Ò
Ultra-15 concentrators (Millipore GmbH, Schwalbach,
Germany) with a molecular mass cut-off of 10 kDa (DptF)
and 50 kDa (DptE). Protein concentrations were determined
by NanoDropÒ spectrophotometer ND-1000 (PeqLab
Biotechnologie GmbH, Erlangen, Germany) measurements.
The affinity-purified proteins were stored at )80 °C.
In vitro 4¢-phosphopantetheinylation of apo-DptF
A reaction mixture containing 200 lm fluoresceinyl CoA or
CoASH [42], 50 lm DptF, 10 mm MgCl
2
and 0.5 lm recom-
binant Bacillus subtilis 4¢-phosphopantetheine transferase
Sfp in assay buffer (50 mm phosphate buffer, 100 mm
NaCl, pH 7.0) was incubated at 37 °C for 5–30 min and
analysed on an SDS–PAGE gel by measuring the in-gel
fluorescence. The Sfp substrate fluoresceinyl CoA
was generated as previously described [23]. The CoASH
Lipidation of daptomycin M. Wittmann et al.
5350 FEBS Journal 275 (2008) 5343–5354 ª 2008 The Authors Journal compilation ª 2008 FEBS
modification of DptF was verified by ESI-MS using
an LTQ-FT mass spectrometer (Thermo Fisher Scientific,
Bremen, Germany).
ATP-pyrophosphate exchange assay
The ATP ⁄ PP

GmbH and Co. KG, Karlsruhe, Germany), the charcoal-
bound radioactivity was determined by liquid scintillation
counting using a 1900CA Tri-carb liquid scintillation
analyser (Packard Instruments, Meriden, CT, USA).
Activity assay of DptE with CoASH
Acyl CoASH synthetases ⁄ ligases are thought to catalyse the
thioesterification of a fatty acid with CoASH. In this study,
we showed that DptE was not able to react with CoASH
as a substrate. However, a typical reaction mixture
(100 lL) was composed of 50 mm phosphate buffer,
100 mm NaCl, 10 mm MgCl
2
,1mm ATP, 300 lm CoASH,
500 lm decanoic acid, 1% dimethylsulfoxide and 1 mm
DptE. After incubation at 37 °C for 30 min, reactions were
stopped with 10 lL formic acid. The product formation
was measured by HPLC-MS. Separation of the reaction
products was achieved on a 250 ⁄ 3 Nucleosil C8 column
(3 lm, Macherey-Nagel GmbH & Co. KG, Du
¨
ren,
Germany) by applying the following gradient at a flow rate
of 0.3 mLÆmin
)1
[buffer A: 2mm triethylamine ⁄ water; buffer
B: 2mm triethylamino ⁄ 80% acetonitrile ⁄ 20% water (v ⁄ v)],
column temperature 30 °C: loading 5% buffer B, after
5 min linear gradient up to 95% buffer B in 37 min, and
then holding 100% buffer B for 5 min. The product was
identified by UV detection at 215 nm and by on-line

LC-MS approach
To identify decanoic AMP by LC-MS, reactions (100 lL)
containing decanoic acid (500 lm), ATP (1 lm), MgCl
2
(10 mm), apo-DptF (50 lm), 1% dimethylsulfoxide and
phosphate buffer (pH 7.0, 50 mm) were performed at
37 °C. Reactions were initiated by addition of DptE (5 lm)
and stopped after 1 h by addition of 30 lL formic acid.
Samples were analysed by HPLC-MS as described above.
ATP/PP
i
-exchange approach
For activity measurements, DptE (1 lm) was rapidily mixed
with 0.15 lCi (16 CiÆmmol
)1
) hot PP
i
in the presence of
500 lm decanoic acid, 1% dimethylsulfoxide, 10 mm
MgCl
2
,1mm ATP, 10 lm apo-DptF and 5 mm NaPP
i
phosphate buffer (pH 7.0, 50 mm)at37°C. The enzyme
activity was also checked in the absence apo-DptF, hot PP
i
,
DptE or MgCl
2
as control reactions. The reactions were

data to the Michaelis–Menten equation.
Determination of DptE specificity towards other
ACPs
E. coli HM404 cells (E. coli M15 ⁄ pREP4-gsp transformed
with pQE60-acpK) [43] were a gift from H. D. Mootz
(Fachbereich Chemische Biologie, Technische Universita
¨
t
Dortmund, Germany). The expression The E. coli HM404
cells were grown in the presence of 25 lgÆmL
)1
kanamy-
cin, induced, harvested and disrupted, and the crude cell
extract was centrifuged as described above for DptF. Pro-
tein purification was performed as described previously
[43]. The yield of purified protein was 5.5 mgÆL
)1
of
culture (Fig. 7).
The lipD gene was amplified from genomic DNA using
Phusion DNA polymerase (Finnzymes) and the synthetic
oligonucleotide primers 5¢-AAAAAA
GAATTCATGTCA
GACCTCAGCACCGC-3¢ and 5¢-AAAAA
AAGCTTTCA
GGCGGAACGCAGCTC-3¢ (EcoRI and HindIII restric-
tion sites are underlined). The resulting 291 bp PCR frag-
ment was purified, digested with EcoRI and HindIII, and
ligated into a pET28a(+) derivative (Novagen, Merck
KGaA, Darmstadt, Germany), digested with the same

parameters for the DptE-mediated transfer to holo-LipD
were performed as described above (see Determination of
the kinetic parameters of DptF lipidation by DptE).
Acknowledgements
We thank Dr Georg Scho
¨
nafinger, Dr Christoph Mahl-
ert and Thomas Knappe (Department of Chemistry ⁄
Biochemistry, Philipps-University Marburg, Germany)
for helpful discussions and critical comments on the
manuscript. Dr Henning D. Mootz provided the
HM0079 and HM404 strains. This work was supported
by the Deutsche Forschungsgemeinschaft and the Fonds
der Chemischen Industrie.
References
1 Miao V, Coeffet-Legal MF, Brian P, Brost R, Penn J,
Whiting A, Martin S, Ford R, Parr I, Bouchard M et al.
(2005) Daptomycin biosynthesis in Streptomyces roseosp-
orus: cloning and analysis of the gene cluster and revision
of peptide stereochemistry. Microbiology 151, 1507–1523.
2 Hojati Z, Milne C, Harvey B, Gordon L, Borg M, Flett
F, Wilkinson B, Sidebottom PJ, Rudd BA, Hayes MA
et al. (2002) Structure, biosynthetic origin, and engi-
neered biosynthesis of calcium-dependent antibiotics
from Streptomyces coelicolor. Chem Biol 9 , 1175–1187.
3 Fukuda DS, Debono M, Molloy RM & Mynderse JS
(1990) A54145, a new lipopeptide antibiotic complex:
microbial and chemical modification. J Antibiot 43,
601–606.
4 Miao V, Brost R, Chapple J, She K, Gal MF &

Hunt AH, Daupert VM, Counter FT, Ott JL, Carrell
CB, Howard LC et al. (1988) Enzymatic and chemical
modifications of lipopeptide antibiotic A21978C: the
synthesis and evaluation of daptomycin (LY146032).
J Antibiot 41, 1093–1105.
11 Schwarzer D, Finking R & Marahiel MA (2003)
Nonribosomal peptides: from genes to products. Nat
Prod Rep 20, 275–287.
12 Kopp F & Marahiel MA (2007) Where chemistry meets
biology: the chemoenzymatic synthesis of nonribosomal
peptides and polyketides. Curr Opin Biotechnol 18, 513–
520.
13 Rausch C, Hoof I, Weber T, Wohlleben W & Huson
DH (2007) Phylogenetic analysis of condensation
domains in NRPS sheds light on their functional evolu-
tion. BMC Evol Biol 7, 78.
14 Trivedi OA, Arora P, Sridharan V, Tickoo R, Mohanty
D & Gokhale RS (2004) Enzymic activation and trans-
fer of fatty acids as acyl-adenylates in mycobacteria.
Nature 428, 441–445.
15 Ray TK & Cronan JE Jr (1976) Activation of long chain
fatty acids with acyl carrier protein: demonstration of a
new enzyme, acyl-acyl carrier protein synthetase, in
Escherichia coli. Proc Natl Acad Sci USA 73, 4374–4378.
16 Powell A, Borg M, Amir-Heidari B, Neary JM,
Thirlway J, Wilkinson B, Smith CP & Micklefield J
(2007) Engineered biosynthesis of nonribosomal
lipopeptides with modified fatty acid side chains. JAm
Chem Soc 129, 15182–15191.
17 Black PN, Zhang Q, Weimar JD & DiRusso CC (1997)

24 Gruenewald S, Mootz HD, Stehmeier P & Stachelhaus
T (2004) In vivo production of artificial nonribosomal
peptide products in the heterologous host Escherichia
coli. Appl Environ Microbiol 70, 3282–3291.
25 Morgan-Kiss RM & Cronan JE (2004) The Escherichia
coli fadK (ydiD) gene encodes an anerobically regulated
short chain acyl-CoA synthetase. J Biol Chem 279,
37324–37333.
26 Fritzler JM & Zhu G (2007) Functional characteriza-
tion of the acyl-[acyl carrier protein] ligase in the Cryp-
tosporidium parvum giant polyketide synthase. Int J
Parasitol 37, 307–316.
27 Sauermann R, Rothenburger M, Graninger W &
Joukhadar C (2008) Daptomycin: a review 4 years after
first approval. Pharmacology 81, 79–91.
28 Li H, Melton EM, Quackenbush S, DiRusso CC &
Black PN (2007) Mechanistic studies of the long chain
acyl-CoA synthetase Faa1p from Saccharomyces
cerevisiae. Biochim Biophys Acta 1771, 1246–1253.
29 Tang GL, Cheng YQ & Shen B (2007) Chain initiation
in the leinamycin-producing hybrid nonribosomal
peptide ⁄ polyketide synthetase from Streptomyces
atroolivaceus S-140. Discrete, monofunctional
adenylation enzyme and peptidyl carrier protein that
directly load d-alanine. J Biol Chem 282, 20273–20282.
30 Hisanaga Y, Ago H, Nakagawa N, Hamada K, Ida K,
Yamamoto M, Hori T, Arii Y, Sugahara M, Kuramitsu
S et al. (2004) Structural basis of the substrate-specific
two-step catalysis of long chain fatty acyl-CoA synthe-
tase dimer. J Biol Chem 279, 31717–31726.

Vater J (2004) Initiation of surfactin biosynthesis and
the role of the SrfD-thioesterase protein. Biochemistry
43, 11331–11343.
39 Sakuno E, Kameyama M, Nakajima H & Yabe K
(2008) Purification and gene cloning of a dehydrogenase
from Lactobacillus brevis that catalyzes a reaction
involved in aflatoxin biosynthesis. Biosci Biotechnol
Biochem 72, 724–734.
40 Hitchman TS, Schmidt EW, Trail F, Rarick MD,
Linz JE & Townsend CA (2001) Hexanoate synthase,
a specialized type I fatty acid synthase in aflatoxin B1
biosynthesis. Bioorg Chem 29, 293–307.
41 Linne U, Schafer A, Stubbs MT & Marahiel MA
(2007) Aminoacyl-coenzyme A synthesis catalyzed by
adenylation domains. FEBS Lett 581, 905–910.
42 La Clair JJ, Foley TL, Schegg TR, Regan CM &
Burkart MD (2004) Manipulation of carrier proteins in
antibiotic biosynthesis. Chem Biol 11, 195–201.
43 Mootz HD, Finking R & Marahiel MA (2001) 4’-phos-
phopantetheine transfer in primary and secondary
metabolism of Bacillus subtilis. J Biol Chem 276,
37289–37298.
44 Pohlmann V & Marahiel MA (2008) Delta-amino group
hydroxylation of l-ornithine during coelichelin
biosynthesis. Org Biomol Chem 6, 1843–1848.
Lipidation of daptomycin M. Wittmann et al.
5354 FEBS Journal 275 (2008) 5343–5354 ª 2008 The Authors Journal compilation ª 2008 FEBS