Báo cáo khoa học: Val216 decides the substrate specificity of a-glucosidase in Saccharomyces cerevisiae doc - Pdf 11

Val216 decides the substrate specificity of a-glucosidase
in
Saccharomyces cerevisiae
Keizo Yamamoto
1
, Akifumi Nakayama
2
, Yuka Yamamoto
1,
* and Shiro Tabata
1
1
Department of Chemistry, Nara Medical University, Japan;
2
Nara Prefectural Institute for Hygiene and Environment, Japan
Differences in the s ubstrate s pecificity o f a-glucosidases
should be due to the differences in the su bstrate binding and
the catalytic domains of the enzymes. To elucidate such
differences of enzymes hydrolyzing a-1,4- and a-1,6-glu-
cosidic linkages, two a-glucosidases, maltase and isomaltase,
from Saccharomyces c erevisiae were cloned a nd analyzed.
The cloned yeast isomaltase and maltase consisted of 589
and 584 amino a cid residues, respectively. There w as 72.1%
sequence identity with 165 amino acid a lterations between
the two a- glucosida ses. These two a-glucosidase genes
were subcloned into the pKP1500 expression vector and
expressed in Escherichia coli. The purified a-glucosidases
showed the same substrate specificities as those of their
parent native glucosidases. Chimeric enzymes constructed
from isomaltase by exchanging with maltase fragments were
characterized by their substrate specificities. When the con-

specific structural features of the catalytic (b/a)
8
-barrel
domain exist in these enzymes [8–10].
The relationship of sequence and structure to substrate
specificity i n family 13 enzymes, particularly a-amylase,
cyclomaltodextrinase, and neo pullulanase, has been well
studied [11–13]. Despite the fact that many a-glucosidases
with diverse substrate specificities h ave been purified and
cloned from mammals, plants, and m icroorganisms, i t i s s till
not clear which amino acid residues of a-glucosidase
recognize t he difference between a-1,4- a nd a-1,6-glucosidic
bonds contained in saccharides.
Yeast contains two a-glucosidases, a-1,4-glucosidase
(E.C. 3.2.1.20, maltase) and oligo-1,6-glucosidase
(E.C. 3.2.1.10, isomaltase), which act preferentially on
maltose or isomaltose and methyl a-
D
-glucopyranoside
(a-mg), respectively. The expression of these e nzymes is
controlled by different polymeric genes, MAL or MGL,
separately [14–16]. Maltase (the MAL6 product of
Saccharomyces carlsbergensis) preferentially hydrolyzed
maltose but neither isomaltose nor a-mg, whereas isomaltase
hydrolyzes isomaltose and a-mg but not maltose [17,18].
Thus, we focused on the structure–function relationship of
the two a-glucosidases f rom Saccharomyces as a model in
respect of the difference in t heir substrate s pecificities.
The yeast genome directory which was constructed by
Goffeau et al. revealed t he existence of many homologo us

We found that one amino acid residue in consensus region
II decided the substrate specificity of isomaltase.
Materials and methods
Materials
The yeast strains used w ere Saccharomyces cerevisiae
D-346 (ATCC 56960) and 727–14C (ATCC 56959). The
bacterial strains and plasmids used were Escherichia coli
JM109, KP3998 [21], pUC18 and pKP1500 [21].
Hydroxyapatite (Gigapite) was purchased from Seika-
gaku Kogyo and hydroxyapatite (Micro-Prep Ceramic
Hydroxyapatite, type I) was from B io-Rad. Maltose,
isomaltose, a-mg, and p-nitrophenyl a-
D
-glucopyranoside
were from Nakalai T esque, Japan. A site-directed muta-
genesis kit (Quickchange
TM
) was obtained from S tratagene
and the bicinchoninic acid protein assay reagent was from
Pierce Chemicals. La-Taq polymerase was purchased from
Takara Syuzo and restriction endonucleases and T4 DNA
ligase were from Takara S yuzo, or New En gland Biolabs.
Reverse transcriptase was used from the Expand
TM
Reverse Transcriptase kit from Boehringer Mannheim.
The Marathon kit was purchased from Clontech Labor-
atory. Oligonucleotides were synthesized by Takara Syuzo
Custom Service.
Assay method for enzyme activity a-glucosidase activity
was determined by measuring the release of p-nitrophenol

chromosome VII of S. cerev isiae [19]. Therefore, the iso-
maltase gene was amplified from the c DNA library by PCR
using t he N-terminal sequence of ORF YGR287c and oligo-
dT as primers . The 1 .8 kb RT-PCR product was ligated to
plasmid pUC 18 after digestion with SmaI and introduced
into E. coli JM109. The insert was sequenced by the dideoxy
method [25] using t he Dye T erminator C ycle Sequencing F S
Ready Reaction kit (Applied Biosystems). To verify the 5 ¢
end sequence, 5¢ RACE was performed using the Marathon
kit with the AP1 primer and a gene-specific pr imer
(5¢-AGATTGCCTTTCTACAGTCTTCATTC-3¢) accord-
ing to the manufacturer’s p rotocol. The 5¢-RACE product
was sequenced by a direct sequencing method.
Subcloning into the pKP1500 expression vector
Forward and reverse primers were designed based on the
5¢-and3¢-terminal nucleotide sequences of the isomaltase
gene (MGL) for cloning into plasmid pKP1500. The
forward p rimer 5¢-ATGACTATTTCTTCTGCACAT
CCAGAGACAGAAC-3¢ con tains the initiation codon,
while the reverse primer 5¢-CTTTCTGCAGACTCA
TTCGCTGATATATATTC-3¢ linked a PstI restriction site
to the termination codon. PCR was carried out on the
isomaltase gene cloned above. PCR products were digested
with PstI. Simultaneously, pKP1500 was digested with
EcoRI and PstI, and then the EcoRI site was blunted by the
use of a Blunting kit (Takara Syuzo). The vector and
the insert MGL gene were ligated with T4 ligase followed by
transformation into E. coli JM109. The cells were plated on
Luria–Bertani agar supplemented with 40 lgÆmL
)1

duced into E. coli KP3998. Several transformants containing
the 1.8 kb insert were selected and sequenced. The plasmid
carrying the maltase gene was designated p YMA.
Expression of recombinant enzymes in
E. coli
and
purification of the enzymes
The E. coli transformant carrying pYIM (or pYMA) was
inoculated into PYG medium [21] supplemented with
50 lgÆmL
)1
of ampicillin and i ncubated at 37 °C. Isopropyl
thio-b-
D
-galactoside (final 1 m
M
) was added when cell
density at A
660
reached 0.5 and the culture was further
incubated for 12 h.
Ó FEBS 2004 Substrate specificity of a-glucosidase (Eur. J. Biochem. 271) 3415
Cells were resuspended in 50 m
M
Tris/HCl buffer
(pH 7 .5) a nd sonicated. The cell-free extract was applied
to a Q AE-Toyopearl column equilibrated with 50 m
M
Tris/
HCl (pH 7.5) and the column was washed with the same

fragment which was introduced at a unique restriction site
by PCR.
Chimeric enzymes MAa/IMb and IMa/MAb were con-
structed by exchanging two Mun I/BglII fragments of pYIM
and pYMA which were cleaved at single restriction sites
with both of these restriction enzymes. The chimeric
enzyme, Mun/Bpu was constructed by inserting a fragment,
which was amplified by PCR with the forward p ri-
mer 5¢-AGAAGCCATT
GCTGAGCAATTTTTGTTC-3¢
(underlining i ndicates t he Bpu1102I restriction site) and t he
reverse primer 5¢-AAA
AAGCTTGCACTAATTTTATTT
GAC-3¢ (underliningindicates the HindIII restriction site and
stop codon, respectively) and pYMA as a template, into IMa/
MAb at Bpu1102I/HindIII. Other c himeric enzymes, M un/
Bst, Mun/Pst, and Pst/Bst were constructed by the same
method described for the Mun/Bpu c himera. The chimeric
enzymes are shown in a sche matic diagram in Fig. 2.
Site-directed mutagenesis
Site-directed mutagenesis (Asp215 fi Ala,Val216 fi Th r,
Gly217 fi Ala, and Ser218 fi Gly of isomaltase) was
carried out by the use of the Quick Change
TM
Site-Directed
Mutagenesis k it and DNA from pYIM as a template and
two additional mutagenic oligonucleotide primers for each
amino acid substitution according to t he instruction man-
ual. The sites to which the mutation was introduced were
sequenced to confirm that only the expected mutation had

a-pNPG. The expression of isomaltase in these clones w as
confirmed by their ability to hydrolyze isomaltose and a-mg
but not maltose. The plasmid containing the isomaltase
gene was designated pYIM.
The maltase gene was also isolated f rom the DNA library
of S. cerevisiae by PCR using gene specific primers. The
amplified 1.8 kb fragment was inserted into plasmid
pKP1500 and the resulting plasmid was transformed into
E. coli. KP3998. DNA sequence analysis of the fragment
gave 100% identity to the MAL6 gene [15]. The plasmid
containing the maltase gene was designated pYMA.
Figure 1 s hows a comparison of amino a cid s equences
between maltase and isomaltase. T here is 72.1% of sequence
identity with 165 amino acid alterations.
Assessment of recombinant enzymes in comparison
with native a-glucosidases
We assessed the tw o recomb inant a-glucosidases in terms of
substrate specificity and immunological identity and com-
pared them to their native enzymes. The two recombinant
a-glucosidases showed the same substrate specificities as
those of their parent glucosidases, namely, maltase hydro-
lyzed maltose but not isomaltose and a-mg, whereas
isomaltase hydrolyzed isomaltose and a-mg but not malt-
ose. Upon double i mmunodiffusion, rabbit antiserum
against native isomaltase produced a single precipitation
line without spurs with recombinant isomaltase (data not
shown). When the two recombinant enzymes reacted with
antisera against n ative maltase and isomaltase, the recom-
binant enzymes showed the s ame dos e–response a s t he
native enzymes by antiserum neutralization (data not

Bst, respectively). The specific activity for isomaltose of
Mun/Bpu and Mun/Bst were about 10 and 80 times lower
than that of isomaltase, respectively. The K
m
for a-pNPG of
Mun/Bpu was the same a s that of isomaltase, whereas the
K
m
for a-pNPG of M un/Bst was about 50 times l ower than
that of isomaltase. T hus, fragments including consensus
regions III and IV may affect the substrate affinity of the
a-glucosidases. To investigate the role of the fragment
containing consensus r egion II, two c himeras, Mun/Pst a nd
Pst/Bst, were constructed. In the Mun/Pst chimera, a 27
amino acid fragment of Mun/Bst including consensus
Fig. 1. Comparison of amino a cid sequences
between maltase and is oma ltase. Identical and
similar amino acid resi dues are designated by
*andÆ, respectively. Four highly co nserved
regions of family 13 are underlined.
Fig. 2. Schematic diagram of the chimeric en zymes. Isomaltase se-
quenceisrepresentedasanopenbarandmaltasesequenceisrepre-
sented as a s haded bar. MunI, Pst I, BstBI, and Bpu1102I are r estriction
sites used for the construction o f chimeric enzymes. I, II, III, and IV
indicate the l ocation of f o ur highly c onserved regions of f amily 13.
Ó FEBS 2004 Substrate specificity of a-glucosidase (Eur. J. Biochem. 271) 3417
region II was replaced by the corresponding fragment of
pYMA. The substrate s pecificities of M un/Pst changed
completely to those of maltase type. However, the charac-
teristics of Pst/Bst which contained only the 27 amino acid

Tris/HCl buffe r, pH 7.5, then r eleased glucose w as assayed. For
a-pNPG, an increase of absorbanc e at 41 0 n m was me asured in 5 m
M
a-pNPG in 0 .1
M
sodium ph osphate b uffer, pH 7.0 at 30 °C.
Enzyme
Specific activity (lmolÆmin
)1
Æmg
)1
enzyme)
K
m
for
a-pNPG (m
M
)
Maltose Isomaltose a-mg a-pNPG
Maltase 70.0 0.00 0.00 132 0.31
Isomaltase 0.00 46.0 48.0 92.0 2.13
MAa/IMb 36.6 0.00 0.00 126 0.30
IMa/MAb 0.00 30.0 21.0 57.0 1.26
Mun/Bpu 0.00 4.40 2.30 34.0 3.32
Mun/Bst 0.00 0.69 0.23 5.30 0.045
Mun/Pst 34.0 0.00 0.00 98.0 0.15
Pst/Bst 0.00 0.46 0.23 5.70 0.043
Table 2. Kinetic parameters of wild-type isomaltase and site-directed
mutants. TheconsensusregionIIofisomaltasewasmutatedtothe
maltase type by site-directed mutagenesis. For example, V216T was

B. thermoglucosidasius oligo-1,6-glucosidase [27]; Bce, B. ce reus suc-
rase-isomaltase [28]; Bco, B. coagulans sucrase-isomaltase [29]; Bsp1,
Bacillus sp. D G0303 a-glucosidase [30] , Bsp2, Basillus sp . F5 sucrase -
isomaltase [31]; Bfl, B. flav ocaldarius oligo-1,6-glucosidase [32]; Spn,
Streptococcus pneumoniae a-1,6-glucosidase [33]; Bsu, B. subtilis suc-
rase-isomaltase-maltase [34]; B sp3, Bacillus sp. a-glucosidase [35], T cu,
Thermomonospora curvata a-glucosidase [36] ; Sce727–14C, S. cerevis-
iae maltase (this study); Sca, S. c arlsbergensis maltase [20]; C al,
C. albicans maltase [37]; H po, Hansenula polymorpha maltase [38].
3418 K. Yamamoto et al.(Eur. J. Biochem. 271) Ó FEBS 2004
S218G) exhibited a change in the h ydrolyzing ratio o f
maltose/isomaltoseto5:1,3:1,and10:1,respectively.
These facts indicate that the three residues in consensus
region II, particularly Val, plays an importan t role in
distinguishing between the a-glucosidic linkages of a-1,4
and a-1,6.
McCarter and Withers [26] indicated that Asp214 on
the consensus region II of maltase is the catalytic
nucleophile. Because the Asp214 of maltase is equivalent
to the Asp215 of isomaltase, a mutant with the residue
altered to Ala was tested for its activity on a-pNPG.
None of the mutants including D215A had activity on
a-pNPG and a-mg although the proteins were detected
with antiserum against isomaltase by immunoblotting
(data not shown). T hus, the Asp215 of isomaltase is one
of three active acidic residues which are completely
conserved in a-glucosidase group.
Amino acid sequence alignment
Figure 3 shows the amino acid sequence alignment of the
consensusregionIIofa-glucosidases o f known substrate

further understanding the structure-function relationship of
family 13 a-glucosidases.
References
1. Henrissat, B. (1991) A c lassifocation of glycosyl hydrolases based
on ami n o acid s equence similarities. Biochem. J. 28 0 , 309–316.
2. Henrisaat, B. (1996) Updating the sequence-based c lassification of
glucosyl hydrolases. Bioc hem. J. 316, 695–696.
3. Matsuura, Y., Kusunoki. M., Harada, W. & Kakudo, M. (19 84)
Structure and possible catalytic residues of Taka-amylase A.
J. Bi ochem. 95, 697 –702.
4. Nakajima, R., Imanaka, T. & Aiba, S. (1986) Comparison of
amino acid s equenc es of eleven d ifferent a-amylases. Appl.
Microbiol. Bio technol. 23, 355–360.
5. Svensson, B. (1988) Regional distant sequence homology between
amylases, a-glucosidases, and transglucanosylases. FEBS Lett.
230, 7 2–76.
6. Machius, M., Wiegand, G. & H uber, R . (1995) Crystal s tructure
of calcium-depleted Bacillus licheniformis a-amylase at 2.2 A
˚
Resolution. J. Mol. Biol. 246 , 545–559.
7. Brayer, G .D., Luo, Y. & Withers, S.G. (1995) The structure of
human pancreatic a-amylase at 1.8 A
˚
resolution an d c omparisons
with related en zymes. Protein Sci. 4, 1730 –1742.
8. Jespersen,H.M.,MacGregor,E.A.,Sierks,M.R.&Svensson,B.
(1991) Comparison of the domain-level o rganization of starch
hydrolases and related e nzymes. Biochem. J. 28 0, 51–55.
9. Jespersen, H.M., MacGregor, E.A., Henrissat, B., Sierkes, M.R.
& Svensson, B. (1993) Starch and glycogen-debranching and

of sequence and structure to specificity in the a-amylase family of
enzymes. Biochim. Biop hys. Acta 1546, 1–20.
14. Carlson, M. (1987) Regulation of sugar utilization in Saccharo-
myces species. J. Bacteriol. 169, 4873–4877.
15.Vanoni,M.,Sollitti,P.,Goldenthal,M.&Marmur,J.(1989)
Structure and regulation of the multigene family controlling
maltose fermentation in budding yeast. Prog. Nucleic Acid Res.
Mol. Biol. 37, 281–322.
16. Johnson, M. & Carlson, M. (1992) Regulation of carbon and
phosphate utilization. In The Molecular and C elullar Biology of
Yeast Saccharomyces: Gene Expression (Johns, E .W ., Prngle, J.R.
& Broach, J., eds), pp. 193–281. Cold Spring Harbor Laboratory
Press, Cold Spring Harbor, NY.
17. Khan, N.A. & Eaton, N.R. (1 967) Purification and characteriza-
tion of maltase and a-methyl glucosidase from yeast. Biochim.
Biophys. A cta 146, 173–180.
18. Needleman, R.B., F ede roff, H.J., Eccleshall, T.R., Buchferer, B. &
Marmur, J . (1978) Purific ation and c haracterization of a-glucosi-
dase from Sacchromyces carlsbergensis. Biochemistry 37, 4567–
4661.
19.Goffeau,A.,Aert,M.L.,Agostini-Carbone,A.,Ahmed,M.,
Aigle, L., Alberghina, K., Albermann, M., Albers, M., Aldea, D.,
Alexandraki, G., et al. (1997) Th e yeast g eno me directory . Nature
387 (Suppl ), 1–105.
20. Hong, H.S. & Marmur, J. (1986) Primary s equence o f t he m altase
gene of th e MAL6 l o cus of Saccharomyces carlsbergensis. Gene 41,
75–84.
21. Miki, T., Yasukochi, T., Nagatani, H., Furuno, M., Orita, T.,
Yamada, H., Imoto, T. & Horiuchi, T. (1987) Construction of
a plasmid vector for the regulatable high level expression of

29. Suzuki, Y . & Tomura, Y. (1986) Purification and characterization
of Bacillus c oagulans oligo-1,6-glucosidase. Eur. J. Bioc hem. 15 8,
77–83.
30. Lee, Y E. (2000) Cloning and characterization of a-glucosidase
gene from thermophilic Bacillus sp. DG0303. J. Microbiol. Bio-
technol. 10, 244–250.
31. Yamamoto, M. & H orikoshi, K. (1990) Nucleotide sequence of
alkalophilic Bacillus olig o-1,6-glucosidase geneandtheproperties
ofthegeneproductinEscherichia c oli HB101. Denpun Kag aku 37,
137–144.
32. Kashiwabara, S., M atsuki, Y ., Kishimoto, T. & Suzuki, Y. ( 1998)
Clustered proline r esid ues a roun d t he active-site cleft in therm o-
stable oligo-1,6 glucosidase of Bacillus flavocaldarius KP1228.
Biosci. B iotechnol. B iochem. 62 , 1093–1102.
33. Coffey, T.J., Enright, M .C., Daniels, M., M orona, J.K., Morona,
R., H ryniewicz, W., Paton, J.C. & Spratt, B.G . (1998)
Recombinational exchanges at the capsular polysaccharide bio-
synthetic locus lead to frequent serotype changes among natural
isolates of Stre ptococcus pne umoniae. Mol. Microbiol. 27 , 73–83.
34. Scho
¨
nert, S., Buder, T. & D ahl, M.K. (1998) Identification and
enzymatic characterization of the maltose-inducible a-glucosidase
MalL (sucras e-isomaltase-maltase) of Bacillus subtilis. J. Bacteriol.
180, 2 574–2578.
35. Nakao, M., N akayama, T., Kakudo, A., Inohara, M., Harada,
M., O mura, F. & Shibano, Y. (1994) Struc ture and expression of a
gene coding for t hermostable a-glucosidase with a broad substrate
specificity from Bacillus sp. SAM1606. Eur. J. Biochem. 220, 293–
300.

D
, a program for
photorealistic molecular graphics, Version 2.0. Acta Crystallog.
Sect. D 50, 869–873.
3420 K. Yamamoto et al.(Eur. J. Biochem. 271) Ó FEBS 2004


Nhờ tải bản gốc

Tài liệu, ebook tham khảo khác

Music ♫

Copyright: Tài liệu đại học © DMCA.com Protection Status