Báo cáo Y học: The analysis of the fine specificity of celiac disease antibodies using tissue transglutaminase fragments pot - Pdf 11

The analysis of the fine specificity of celiac disease antibodies using
tissue transglutaminase fragments
Daniele Sblattero
1
, Fiorella Florian
1
, Elisabetta Azzoni
1
, Trevin Zyla
3
, Min Park
3
, Valentina Baldas
2
,
Tarcisio Not
2
, Alessandro Ventura
2
, Andrew Bradbury
3,4
and Roberto Marzari
1
1
Dipartimento di Biologia, University of Trieste, Trieste, Italy;
2
IRCSS, Burlo Garofolo, Trieste, Italy;
3
Biosciences Division;
Los Alamos National Laboratory, Los Alamos, New Mexico, USA;
4

transglutaminase (tTG) [3]. tTG or type 2 transglutaminase
is a member of a family of seven isoforms of enzymes
involved in protein cross-linking, including prostatic TGase
and factor XIII. tTG is a Ca
2+
-dependent ubiquitous
intracellular enzyme that catalyzes the covalent and irre-
versible formation of gamma glutamyl-lysine bonds [4].
Furthermore, tTG plays a role in the transduction of
extracellular signals, mediated by its additional GTP-
hydrolyzing activity [5], analogous to that of G-proteins
found in adrenergic receptor transduction pathways [6].
Finally, tTG seems to play a critical role in controlling cell
and tissue homeostasis regulating the cell cycle through its
involvement in proliferation, terminal differentiation and
apoptotic processes [7]. The first TGase structure deter-
mined has been that of human factor XIIIA [8]. On the basis
of sequence homology with factor XIII and by computer
modeling and experimental approaches, a structural model
for tTG has been proposed by Casadio et al.[9]andvery
recently, the X-ray structure of the human tTG complexed
with GDP, determined [10]. Human tTG consists of four
domains: the N domain, with a b-sandwich structure, the
enzyme core domain, formed by a series of a-helices, and
two C-terminal domains, C1 and C2, containing b-struc-
tures arranged in barrel-like conformations. The catalytic
site, the so called triad [11], formed by Cys277, His335 and
Asp358, and also the Ca
2+
[12] and GTP binding sites are

D
-galactoside; scFv, single-chain antibody fragment;
TMB, 3,3¢,5,5¢-tetramethylbenzidine dihydrochloride; tTG, tissue
transglutaminase.
Enzymes: transglutaminase (EC 2.3.2.13).
(Received 6 June 2002, revised 2 August 2002,
accepted 29 August 2002)
Eur. J. Biochem. 269, 5175–5181 (2002) Ó FEBS 2002 doi:10.1046/j.1432-1033.2002.03215.x
the VH5 antibody family and were also able to recognize
guinea-pig (GP) tTG, which the other was not.
In this study, we report the cloning and expression of tTG
gene fragments in order to map the antigenic regions
recognized by these monoclonal phage antibodies as well as
sera from CD patients.
MATERIALS AND METHODS
Bacterial strains
DH5aF¢ {F¢/endA1 hsdR17 (r
K–
m
K+
) supE44 thi-1 recA1
gyrA (Nal
r
) relA1 D (lacZYA-argF)U169 deoR [F
80
dLac-
D(lacZ)M15]} was used for cloning, and HB2151 [K12, ara
D(lac-pro),thi/F¢ proA
+
B

-galacto-
side (IPTG) and incubated at 28 °C for an additional 5 h.
The soluble cytoplasmic fraction was prepared by extraction
of pelleted bacteria with lysozyme 1 mgÆg
)1
bacteria in lysis
buffer (20 m
M
Tris pH 8.0, 500 m
M
NaCl, 5 m
M
imidazole,
0.1% Triton X 100, 20 lgÆmL
)1
DNase) followed by centri-
fugation for 15 min at 27 000 g. The supernatant was col-
lected and dialyzed against NaCl/P
i
(Na
2
HPO
4
/NaH
2
PO
4
10 m
M
pH 7.4, NaCl 0.15

i
plus 0.1%
Tween20 and three times with NaCl/P
i
. Primary antibodies
used were CUB7402, a commercial anti-tTG Ig (Neo-
marker), His-probe H3, an anti-histidine tag Ig (Santa
Cruz), soluble cloned scFvs to tTG as previously described
[16] and human sera. The antibodies were used as following:
(a) CUB7402, diluted 1 : 1000 with MPBS and His-probe
diluted 1 : 1000 followed by goat anti-(mouse IgG)
conjugated with HRP (Dako) (b) scFvs, diluted 1 : 1,
mAb recognizing the SV5 tag [18] found at the scFv C
terminus followed by goat anti-(mouse IgG) conjugated
with HRP (Dako); (c) human sera, diluted 1 : 200 followed
by goat anti-(human IgA) conjugated with HRP
(Sigma). All the immunocomplexes were revealed with
Table 1. Primers used to amplify 12 tTG deletion mutants. Enzyme restriction sites for BglII and EcoRI are in italics. The bold sequences correspond
to the tTG gene.
Primer name Primer sequence Amino acids
N back AGCTCG
AGATCT
ATGGCCGAGGAGCTGGTCTT 1–7
Core back AGCTCG
AGATCT
AACGCCTGGTGCCCAGCGGA 140–147
Core for TGAAGC
GAATTC
TTACTCCCTCTCCTCTGAGGACC 454–448
Loop for TGAAGC

TTATGGAACTGGGCCACAGCA 376–371
5176 D. Sblattero et al. (Eur. J. Biochem. 269) Ó FEBS 2002
3,3¢,5,5¢-tetramethylbenzidine dihydrochloride (TMB) and
H
2
O
2
as substrates and read at A
450
.
Western blotting
SDS/PAGE was performed according to standard tech-
niques. Purified tTG fractions were separated by SDS/
PAGE and transferred onto nitrocellulose (Amersham) by
semi-dry blotting using the Pharmacia Multiphor II. The
membrane was blocked using MPBS for 1 h at room
temperature. CUB7402 and His-probe were used as primary
antibodies. After 2 h incubation at room temperature and
extensive washing with NaCl/P
i
plus 0.1% Tween 20, the
nitrocellulose was subsequently incubated with goat anti-
(mouse IgG) conjugated with alkaline phosphatase and
revealed by the chromogenic substrate BCIP (5-bromo-4-
chloroindol-3-yl phosphate) and Nitro Blue tetrazolium.
RESULTS
Cloning strategy
In a previous paper [16] we described the cloning of human
tTG in the pTrcHisB expression vector. Although this
cloning was effective, most of the tTG synthesized in

cloning primers and restriction digestion of plasmid DNA.
Clones were grown in liquid medium to D
600
¼ 0.5, induced
with IPTG for 5 h and fragments purified by Ni/nitrilotri-
acetic acid chromatography. The eluted fractions were
checked by SDS/PAGE and Western blotting. For this
purpose, two commercial mAbs were used as primary
antibodies: His-probe, a mAb directed to the six histidines
inserted at the N-terminus of the tTG fragments and
CUB7402, which recognizes a linear tTG epitope (amino
acids 447–478) located at a sequence overlapping the
C-terminal end of the core and the nearby loop. The
results of the Western blotting are depicted in Fig. 2. Using
His-probe, all the expressed tTG fragments showed elec-
trophoretic bands corresponding to the predicted molecular
weight (Fig. 2A). When the mAb CUB7402 was used
(Fig. 2B), all fractions had the same pattern, with the
exception of tTG/1, /4, /11 and /12 which lack the epitope
recognized by this antibody. Although all the fragments
showed bands with seemingly little or no proteolytic
degradation, differences in the intensity of the bands were
noted, probably reflecting different expression and/or
purification efficiencies. In Coomassie blue-stained
SDS/PAGE gels, all fractions showed a purity greater than
90% (not shown).
tTG fragments recognition by cloned antibodies
Full-length tTG and derived fragments were tested for their
ability to be recognized by the previously selected human
anti-tTG Igs [16]. Prior to that, the purified tTG fragments

similar immune response arises in different CD patients. In
fact, the 10 antibodies tested were cloned from three CD
patients and this might be interpreted as a distinctive trait of
CD. The responses of four antibodies belonging to Ep1/
GP+ and Ep2/GP– clusters are reported in Fig. 3 as
examples. To avoid interference due to the different
affinities of the antibodies for the antigen, the A values
corresponding to interaction with full-length tTG have been
set to 100 and the A values for the individual tTG fragments
have been normalized as a corresponding percentage. From
Fig. 3 it is clear that the antibodies recognize the fragments
tTG/1, /2, /3, /7 and /11 but not tTG/4, /5, /6, /8, /9, /10 and
/12. A difference in the level of recognition was registered
for fragments tTG/2 and tTG/3, where the reactivity is, on
an average, far lower for the Ep2/GP– than the EP1/GP+
antibodies, reaching a reduction of around 75% for tTG/2.
All antibodies were tested on unrelated proteins such as
BSA, gliadin and lysozyme giving A values not exceeding
0.08.
Experiments in which the tTG was indirectly coupled to
the ELISA plates using purified rabbit anti-tTG serum
Igs gave similar results, indicating that significant denatur-
ation upon binding to the plastic is not occurring (not
shown).
tTG fragments recognition by CD sera
The tTG fragments were also tested with 24 sera from
untreated CD patients. The results, reported as reactivity of
the 24 sera against a given fragment are shown in Fig. 4A.
Also in this case reactivity to full-length tTG, with ELISA A
values comprised between 0.2 and 2, is set to 100% for

extent. The results of the two experiments were roughly the
same for both IgA and IgG. No reactivity (A <0.2)was
registered on all tTG fragments using control sera from 20
healthy donors.
DISCUSSION
The cloning of tTG fragments on the basis of the modeled
three-dimensional structure [8–10] coupled with the map-
ping of the residues involved in the functionality of the
molecule [5,10,19] allowed us to express and purify stable
tTG domain polypeptides. The low degree of protein
degradation, as attested by Western blotting, probably
reflects the fact that individual domains, which are likely to
be resistant to bacterial proteases, were expressed. Although
not examined formally, these fragments were found to be
stable, as little or no degradation, as well as no change in
ELISA A values, were registered after months of storage at
)20 °C.
By using mAbs recognizing the His tag and a linear
epitope within tTG as positive controls for expression, we
were able to normalize the coating of these fragments to
ELISA wells for a better interpretation of the reactivity of
cloned antibodies and patients’ sera. The overall response
of the cloned antibodies indicates that the recognized
region is located in the core of tTG spanning a sequence
not exceeding 237 amino acids (amino acids 140–376), as
proved by the reactivity of tTG/11, tTG/7, which overlap
by this region only. However, this conclusion is slightly
complicated by the lack of recognition of this core element
by tTG/4,/5,/6, which nevertheless contain it. This suggests
the epitope is a conformational one which requires full-

the same reactivity pattern, attesting the presence of
antibodies recognizing both Ep1 and Ep2, whereas no
reactivity to all the tTG fragment was registered using sera
from healthy donors. It has been proposed that phage
antibody libraries may be used as surrogates for the
humoral immune response of an autoimmune patient. In
our case, agreement was almost perfect, confirming that
the humoral autoimmune response in CD involves two
main immunodominant epitopes, with no exceptions noted
among the limited number of sera tested. A further control
Fig. 4. ELISA of tTG and tTG fragments. Full-length tTG are set to 100 and the A values for the individual tTG fragments normalized as a
corresponding percentage. (A) Primary antibody, 24 sera from untreated CD patients. (B) Primary antibody, 12 sera from non-CD patients affected
by other pathologies and with a serum antibody response to tTG. Secondary antibodies, goat anti-(human IgA) conjugated with peroxidase. The
dash represents the average of the values.
Ó FEBS 2002 Epitope mapping of anti-tTG Igs (Eur. J. Biochem. 269) 5179
is given by the use of sera to tTG from nonceliac donors.
All these patients were affected by non CD pathologies but
with a detectable serum titer to tTG. In this case, all tTG
fragments were recognized, including those not recognized
by CD sera. This finding suggests that the epitope/s
identified by the antibody clones are a distinctive marker of
CD and raises the question whether they may play a role
in the onset of the illness. In a recent work, Seissler et al.
[20] analyzed the recognition pattern of CD sera by using
tTG deletion mutants similar to those described in this
work. The authors find similar results to ours, with the
exception of their response to the C terminus, which was
absent in our analyses. This is likely to be due to the
differences in the methods used (immunoprecipitation of
radioactive tTG instead of ELISA on plastic bound

inhibition of the enzymatic activity of tTG by CD
autoantibodies should be carefully considered. CD is
frequently accompanied by other autoimmune pathologies
whose onset might be strictly related to CD, as in patients
on gluten-free diet the risk of other autoimmune disorders
drops dramatically [23]. Transgenic mice lacking tTG have
been shown to exhibit altered thymocyte populations
[24,25]. The question arises whether antibodies to tTG
occurring in CD may cause autoimmune cell clones to
escape negative selection and apoptosis as recently pro-
posed [26]. Our procedure offers a novel approach for
the characterization of conformational epitopes possibly
involved in these mechanisms.
ACKNOWLEDGMENTS
This study was supported by grants n.E.1141 from Telethon and
number 2001063713/002 from MIUR.
REFERENCES
1. Goggins, M. & Kelleher, D. (1994) Celiac disease and other
nutrient related injuries to the gastrointestinal tract. Am. J. Gas-
troenterol. 89, S2–S17.
2. Wieser, H. (1996) Relation between gliadin structure and coeliac
toxicity. Acta Paediatr. Suppl. 412, 3–9.
3. Dieterich, W., Ehnis, T., Bauer, M., Donner, P., Volta, U.,
Riecken, E.O. & Schuppan, D. (1997) Identification of tissue
transglutaminase as the autoantigen of celiac disease. Nat. Med. 3,
797–801.
4. Greenberg, C.S., Birckbichler, P.J. & Rice, R.H. (1991) Trans-
glutaminases: multifunctional cross-linking enzymes that stabilize
tissues. FASEB J. 5, 3071–3077.
5. Iismaa,S.E.,Wu,M.J.,Nanda,N.,Church,W.B.&Graham,

for bovine aortic- endothelial-cell transglutaminase. Eur. J. Bio-
chem. 202, 15–21.
13. McIntosh, R.S., Asghar, M.S., Watson, P.F., Kemp, E.H. &
Weetman, A.P. (1996) Cloning and analysis of IgG kappa and
IgG lambda anti-thyroglobulin autoantibodies from a patient with
Hashimoto’s thyroiditis: evidence for in vivo antigen-driven rep-
ertoire selection. J. Immunol. 157, 927–935.
14. Finnern, R., Bye, J.M., Dolman, K.M., Zhao, M.H., Short, A.,
Marks, J.D., Lockwood, M.C. & Ouwehand, W.H. (1995)
Molecular characteristics of anti-self antibody fragments against
neutrophil cytoplasmic antigens from human V gene phage dis-
play libraries. Clin. Exp. Immunol. 102, 566–574.
15. Marks, J.D., Hoogenboom, H.R., Griffiths, A.D. & Winter, G.
(1992) Molecular evolution of proteins on filamentous phage.
Mimicking the strategy of the immune system. J. Biol. Chem. 267,
16007–16010.
16. Marzari, R., Sblattero, D., Florian, F., Tongiorgi, E., Not, T.,
Tommasini,A.,Ventura,A.&Bradbury,A.(2001)Molecular
dissection of the tissue transglutaminase autoantibody response in
celiac disease. J. Immunol. 166, 4170–4176.
17. Gentile, V., Saydak, M., Chiocca, E.A., Akande, O., Birckbichler,
P.J., Lee, K.N., Stein, J.P. & Davies, P.J. (1991) Isolation and
characterization of cDNA clones to mouse macrophage and
5180 D. Sblattero et al. (Eur. J. Biochem. 269) Ó FEBS 2002
human endothelial cell tissue transglutaminases. J. Biol. Chem.
266, 478–483.
18. Hanke, T., Szawlowski, P. & Randall, R.E. (1992) Construction
of solid matrix–antibody–antigen complexes containing simian
immunodeficiency virus p27 using tag-specific monoclonal anti-
body and tag-linked antigen. J. Gen. Virol. 73, 653–660.

Ó FEBS 2002 Epitope mapping of anti-tTG Igs (Eur. J. Biochem. 269) 5181


Nhờ tải bản gốc

Tài liệu, ebook tham khảo khác

Music ♫

Copyright: Tài liệu đại học © DMCA.com Protection Status