Functional analysis of a small heat shock/a-crystallin protein
from
Artemia franciscana
Oligomerization and thermotolerance
Julie A. Crack, Marc Mansour, Yu Sun and Thomas H. MacRae
Department of Biology, Dalhousie University, Halifax, Nova Scotia, Canada
Oviparously developing embryos of the brine shrimp,
Artemia franciscana, synthesize abundant quantities of a
small heat shock/a-crystallin protein, termed p26. Wild-typ e
p26 functions as a molecular chaperone in vitro and is
thought to help encysted Artemia embryos survive severe
physiological stress encountered during diapause and
anoxia. Full-length and truncated p26 cDNA derivatives
were generated by PCR amplification of p26-3-6-3, then
cloned in either pET21(+) or pRSETC and expressed in
Escherichia c oli BL21 (DE3). A ll constr ucts gave a polypep-
tide detectable on Western blots with either p26 specific
antibody, o r w ith antibody to the H is
6
epitope tag encod ed
by pRSETC. Full-length p26 in cell-free extracts of E. coli
was a bout equal i n mass to t hat f ound in Artemia embryos,
but p26 lacking N- and C-terminal r esidues remained e ither
as monomers or small multimers. All p26 constructs
conferred thermotolerance on transformed E. coli, although
not all formed oligomers, and cells expressing N-terminal
truncated derivatives of p26 were more heat resistant than
bacteria expressing p26 with C-terminal d eletions. The
C-terminal extension o f p26 is seemingly more i mportant for
thermotolerance than is the N-terminus, and p26 protects
E. coli against heat shock when oligomer size and protein
formation, subunit exchange, and capture of unfolding
proteins [12,18,20–26].
Small heat shock/a-crystallin proteins confer thermotol-
erance upon cells [27–33], protect against apoptotic death
[34,35] and have chaperone activity in vitro, wherein the
aggregation of client proteins is prevented [36–38]. Chap-
eroning is thought to depend upon formation of oligomers
that reach 800 kDa in mass and possess quaternary
structure modifiable by environmental parameters
[8,18,20,22,39,40]. Oligomers exhibit dynamic equilibrium
with constituent subunits, which can affect chaperoning but
is not in itself sufficient to ensure chaperone activity
[25,41,42]. A small h eat shock/a-crystallin protein from
Methanococcus jannaschii,termedMjhspl6.5,hasbeen
crystallized, revealing highly o rdered oligomers of 24
subunits with a hollow center [9]. Cryoelectron microscopy
of small heat shock/a-crystallin proteins from several
sources has shown, however, that oligomer structure ranges
from well d efined to variable, leading to the idea that
structural plasticity elicits low specificity and permits
binding of different target proteins [10,24,42]. Several
molecules of denaturing proteins, present in an unstable
molten globule state, i nteract with a single oligomer when
chaperoning occurs. The proteins are protected from
irreversible aggregation under stress, their activity may be
preserved, and they either refold s pontaneously o r with the
assistance of other chaperones upon release [38,43–46].
Embryos of the brine shrimp, Artemia franciscana,
develop ovoviviparously, leading to release o f swimming
Correspondence to T. H. MacRae, Department of Biology, Dalhousie
guanosine 5¢-tetraphospho-5¢-guanosine (Gp4G), an abun-
dant nucleotide at this developmental stage [55].
Previous work has revealed p26, a small heat shock/
a-crystallin protein found o nly in Artemia undergoing
oviparous development [47–49,56–59]. p26 has chaperone
activity in vitro and i mparts thermotolerance to trans-
formed bacteria [49,57]. Although chaperoning and ther-
motolerance are not necessarily equivalent activities, the
results indicate that p26 prevents irreversible denaturation
of proteins in diapause/encysted Artemia embryos. This
permits spontaneous and/or assisted refolding of proteins,
the former a llowing rapid resumption of d evelopment
under limiting e nergy r eserves, perhaps t o e xploit the
transient occurrence of favourable environmental condi-
tions encountered by Artemia. In the current study,
functions of p26 N- and C-terminal regions were explored
through deletion mutagenesis. Specifically, protein solubil-
ity, oligomerization, and t he thermotolerance of t rans-
formed bacteria were examined. Such information may
illuminate the mechanism by which p26 protects Artemia
from physiological stress experien ced during diapause and
anoxia, thereby enhancing our appreciation of small heat
shock/ a-crystallin proteins.
EXPERIMENTAL PROCEDURES
Cloning of full-length and truncated p26 cDNAs
Full-length and truncated p26 cDNAs were generated by
PCR using p26-3-6-3 cDNA (GenBank accession no.
AF031367) [58] as template, and custom primers possessing
BamHI and XhoI restriction sites on the sense and antisense
oligoneucleotides, r espectively (CyberSyn, Inc., Lenni, PA,
vector, pCRII (Invitrogen, San Diego, CA, USA), using T4
DNA ligase overnight at 14 °C, and E. coli DH5a made
competent by the calcium chloride procedure were trans-
formed with the recombinant DNA [60]. Putative p26
cDNA containing clones were s elected by blue/white
screening using the LacZ system, propagated in LB broth,
and examined by restriction analysis for plasmids incorpo-
rating inserts of t he appropriate size, which were subcloned
into the prokaryotic expression vector pET21(+) (Nov-
agen, Inc., Madison, WI, USA). Briefly, pCRII constructs
and pET21(+) were d igested with BamHI and XhoIbefore
electrophoresis in 1% agarose gels. Linearized pET21(+)
and p26 cDNAs were excised and purified with the GFX
TM
PCR DNA and Gel Band Purification Kit (Amersham-
Pharmacia Biotech). Each p26 cDNA was ligated into
pET21(+) using T4 DNA ligase, and competent E. coli
DH5a were transformed w ith the constructs [60]. Bacteria
containing p26 cDNA of the correct length were identified
by restriction digestion of constituent plasmids followed by
electrophoresis in 1% agarose gels. The p26 cDNAs were
Table 1. Full-length and truncated p26 cDNAs generated by PCR. The p rimers are listed in the 5 ¢fi3¢ direction and restriction sites are underlined.
ATG, start codon; TTA, termination codon; bp, base pair.
p26 cDNAs
Amino acid
residues deleted Designations Primer sequences
Length
(bp/amino acids)
p26-full None (p26-1Bam-s) GCGCGGATCCACCATGGCACTTAACCCATG 576/192
(p26-192Xho-as) CGCGCCTCGAGTTAAGCTGCACCTCCTGATCT
ampicillin was inoculated with a single colony consisting of
transformed bacteria possessing either full-length or trun-
cated p26 cDNA, and incubated with shaking at 37 °C until
the D
600
reached 0.6–1.0. Cultures w ere stored a t 4 °C
overnight before incubation with shaking in 50 mL of f resh
LB medium containing 50 lgÁmL
)1
ampicillin at either
30 °Cor37°C. Isopropyl t hio-b-
D
-galactoside (IPTG) wa s
added w hen the culture reached a D
600
of 0.6–1.0 a nd
incubation continued for 5 h, followed by 5 min on ice and
centrifugation at 5000 g for 5 min at 4 °C. Growth rates of
E. coli transformed with wild-typ e and mutated p26 were
not determined, but the D
600
increases for all cultures were
similar indicating that expressed p26 had no effect on cell
division. The pelleted cells were washed twice with cold
buffer (50 m
M
Tris/HC1, 2 m
M
EDTA, pH 8.0) and
resuspended in 5 mL of the same buffer, before adding
Tween (Tris/NaCl/P
i
with 0.1% Tween 20) , followed by
incubation for 30 min at room temperature with either
anti-p26 Ig [57] or anti-(His
6
tag) Ig (Santa Cruz Biotech-
nology, Inc., S anta Cruz, CA, USA) diluted in HST buffer
(0.01
M
Tris/HC1, 1
M
NaC1,0.5%Tween20,pH7.4).
Blots were washed twice in HST buffer, then in Tris/NaCl/
P
i
/Tween, prior to incubation for 30 min with horseradish
peroxidase (HRP)-conjugated goat anti-(rabbit IgG) I g
(Jackson Immunochemicals, Inc.) diluted in HST buffer.
Membranes were washed twice in HST buffer, twice in
Tris/NaCl/P
i
/Tween and once in T ris/NaCl/P
i
,witheach
wash for 5 min. Immunoconjugates were detected by the
enhanced chemiluminescence (ECL) p rocedure (Amersham
Pharmacia Biotech) following manufacturer’s instructions.
The p 26 bands were scanned with a Bio ÁRad Model
GS-670 Imaging Densitometer and analyzed in
each sample was then electrophoresed in 12.5% SDS
polyacrylamide gels, blotted to nitrocellulose and probed
with antibody to p26. Each molecular mass marker, located
by reading the A
280
of gradient fractions, tended to occur
in seve ral samples, t hus each marker w as centrifuged
separately. The position of the peak tube for each marker
is indicated in the figures.
Thermotolerance of
E. coli
BL21(DE3) expressing p26
Two m illiliters of Luria–Bertani broth containing
50 lgÁmL
)1
ampicillin and 1 m
M
IPTG was inoculated
with a single colony of E. coli BL21(DE3) transformed
with either full-length or truncated p26 cDNA in
pET21(+), and incubated at 30 °C f or 8–9 h. Immediately
before heat shock, 0.5 mL of culture was diluted 1 : 10 in
fresh medium supplemented with 25 lgÁmL
)1
ampicillin.
Cultures were incubated at 5 4 °C in a water bath, 100 lL
samples were removed after 0, 15, 30, 45 and 60 min of
heat shock, diluted in cold LB broth and maintained on ice
prior to plating in duplicate o n LB agar. Colonies were
counted after 20–24 h at 37 °C and all p26 constructs were
p26 cDNA cloned in pET21(+) was sequenced and its
deduced amino-acid sequence determined (not shown).
With one exception, deduced amino-acid sequences of
cDNA products were identical, exclusive of engineered
deletions, to full-length p26. Construct p26-ND60 had a
modified nucleotide at position 407 (numbered as in full-
length p26-3-6-3) that caused a Val136Ala substitution.
Each p26 cDNA had cytosine at position 324, whereas
adenine was reported for p26-3-6-3, and cytosine at
position 354 was replaced by thymine. Neither of these
changes modified the deduced am ino-acid sequence o f
p26. The p26 cDNAs cloned in pET21(+) and utilized in
subsequent experiments are represented schematically in
Fig. 1.
Synthesis of full-length and truncated p26
in
E. coli
BL21(DE3)
Cell free extracts prepared from E. coli transformed with
p26 cDNAs in pET21(+) and induced at 30 °CwithIPTG
were electrophoresed in SDS/polyacrylamide gels and either
stained with Coomassie blue (Fig. 2A) or blotted to
nitrocellulose and probed with antibody to p26 (Fig. 2B).
Only p26-ND36 yielded an additional band visible in stained
gels (Fig. 2A, lane 2). In agreement with this observation,
immunostaining of blots with antibody to p26 gave a strong
reaction with p26-ND36, while bands of lesser intensity were
obtained for p26-full, p26-CD40 and p26-CD10 (Fig. 2B).
Extracts from bacteria transformed with p26-ND60 and
p26-alpha in pET21(+) usually failed to produce visible
pET21(+), and the constructs were use d to transform E. coli
BL21(DE3). MCS, multiple c loning site; Amp, ampicillin resistance;
ori, origin o f replic ation; lac 1, lac operator repressor gene; f1 origin,
filamentous phage origin of replication. Additional description of
clones is available i n Table 1.
936 J. A. Crack et al.(Eur. J. Biochem. 269) Ó FEBS 2002
those seen in E. coli transformed w ith p ET21(+) containing
full-length p26 cDNA (Fig. 4A). p26 purified from Artemia
cysts ocurred as oligomers (not shown) and in cell extracts
from cysts (Fig. 4E) the p26 complexes were slightly larger
in size than these produced by recombinant p 26. As revealed
by sedimentation patterns therefore truncated p26 variants
detectable by antip26 antibody exhibited limited ability t o
oligomerize and/or to interact with other proteins, whereas
full-length p26 in cell free extracts from E. coli and Artemia
formed much larger protein complexes, perhaps due to
oligomer assembly as demonstrated for purified p26.
Thermotolerance of
E. coli
expressing full-length
and truncated p26 cloned in pET21(+)
Bacteria transformed with p26 containing constructs dem-
onstrated greater thermotolerance than cells that had
incorporated only pET21(+) (Fig. 5 ). Maximum tolerance
occurred in bacteria expressing p26-full, but this was only
marginally better than protection conferred by p26-ND36
and p26-ND60, w hich in turn was g reater than t he resistance
afforded by p26-CD40, p26-CD10 and p26-alpha. The insert
(Fig. 5 ) indicates e ither t hat p26 occ urred in cell free extracts
from only four transformed cultures, although a ll exhibited
cDNAs and grown in the presence of IPTG at 30 °C. Samples were
electrophorese d in 12.5% SDS polyacrylamide gels and either stained
with Coomassie blue ( A) or transferred to nitrocellulose and probed
with antibod y t o p26 using the ECL proc edure (B) . E ach lane received
15 lL of cell free extract in A and 10 lLinB.M,molecularmass
markers of 97, 66, 43, 31, 22 and 14 kDa; 1, p26-full; 2, p26-ND36; 3,
p26-ND60; 4, p26-CD40; 5, p26-CD10;6,p26-alpha;7,pET21(+).
Arrowhead, p26-N D36. Panel C, Western blots containing lysates of
transformed E. coli BL21(DE3) grown at 30 °C an d induced with
IPTG were probed with antibody to p26. Film s were scanned and
absorbance of the p26 band in each lane, in arbitrary units, dete r-
mined. The amounts of sample applied t o the gel were: p26-full, 5 lL;
p26-ND36, 1 lL; p26-CD40, 10 lL; p26-CD10, 5 lL. The lanes in
which p26 is not v isible each received 10 lL of l ysate.
Fig. 3. Solubility of p26 synthesized in transformed bacteria. E. coli
BL21(DE3) transformed with p26 cDNA in pET21(+) and ind uced
with IPTG were grown at either 30 °C(A,B)or37°C(C,D)for5h,
following which soluble (A,C) and insoluble (B,D) fractions were
prepared. Twenty microliters of each sample was electrophoresed in
12.5% polyacrylamide gels, blotted to n itrocellulose and probed with
antibody to p26 by the ECL p rocedure. Lane 1, 5 lg of cell free e xtract
protein from Artemia cysts; 2, p26-full; 3, p26-ND36; 4, p26-CD40; 5,
p26-CD10.
Ó FEBS 2002 Small heat shock/a-crystallin protein from Artemia (Eur. J. Biochem. 269) 937
DISCUSSION
Restriction digestion, PCR amplification and sequencing
confirmed the identity of p26 cDNA fragments cloned in
pET21(+) and pRSETC. The deduced amino-acid
sequence fo r each construct was identical to the corre-
sponding region encoded by p26-3-6-3 [58], except for p26-
three independent experiments. Bacteria containing only pET21(+)
did not survive 60 min of heat shock and the curve was terminated at
45 m in I nsert , 10 lL of cell lysate from e ach heat shoc ked culture was
electrophoresed in 12.5% SDS polyacrylamide gels, blotted to nitro-
cellulose and probed with anti-p26 Ig, a procedure re peated for each
heat shock experiment. 1, p26-full; 2, p26-ND36; 3, p26-ND60; 4, p26-
CD40;5,p26-CD10; p26-alpha.
Fig. 6. Expression of p26 cDNA cloned in pRSETC. Cell free protein
extracts were prepared from E. coli transformedwitheitherpRSETC
(A,C) or pET21(+) (B,D) containing p26 cDNA. Dup licate samples
were electrophoresed in 12.5% SDS polyacrylamide gels, transferred
to nitrocellulose and p robed with antibody to either p26 (A,B) or the
(His)
6
epitope tag encoded by pRSETC (C,D). Each lane received
7.5 lL of e xtract. 1, p 26-full; 2, p26-N D60; 3, p26-alpha; 4, vector only.
938 J. A. Crack et al.(Eur. J. Biochem. 269) Ó FEBS 2002
Coomassie blue staining. Probing of Western blots with p26
specific antibodies demonstrated the products of four
constructs in extracts of IPTG induced bacteria, but
polypeptides corresponding to p26-ND60 and p26-alpha
were either absent or recognized poorly by anti-p26 Ig.
Western blots of extracts from E. coli transformed w ith p 26-
full, p26-ND36 and p26-alpha cloned in pRSETC and
probed with antip26 antibody gave results identical to those
just described. However, antibody to His
6
revealed the
epitope tag, and thus p26-ND36 and p26-alpha, in duplicate
samples from pRSETC transformed E. co li. Interestingly,
length p26 to form complexes as large as those in Artemia
may reflect improper post-translational processing of the
protein in E. coli. On the other hand, trivial explanations for
the slightly reduced mass are either that Triton X-100 used
during protein preparation affects quaternary structure or
that oligomerization of p26 and/or its interaction with other
proteins is concentration dependent. The former possibility
was not investigated systematically, but preliminary data
suggest detergent does not affect the ability of p26 to form
large complexes in bacterial extracts. Published results vary
in terms of how the concentration of small heat shock/
a-crystallin proteins influe nces oligomer assembly. F or
example, a-crystallin tends to oligomerize readily, even at
low concentrations [40,42], while Hsp20 oligomerization is
concentration dependent [19]. Expression of full-length p26
cDNA in pRSETC was more than for pET21(+), and the
average size of p26 complexes resolved in sucrose gradients
increased, perhaps as a consequence of greater oligomer-
ization due to higher p26 concentration.
The a bsence in cell free extracts of high molecular mass
complexes when p26 lacks either part or all of the
N-terminus favours a role for this region in oligomer
assembly. R einforcing th is proposal, t etramers are the
maximum size attained by Hspl2.2 and 12.3 from Caenor-
habditis elegans [22], and like p26-ND36, the N-terminal
domains of these proteins are short. High molecular mass
oligomers a re not detected afte r N -terminal deletion of
C. elegans Hsp16.2, although dimers and possibly tetramers
are present [18]. Additionally, H spl2.6 from C. elegans,
with 16 fewer N-terminal residues than Hspl6.2, is mono-
oligomers from smaller building blocks arising by interac -
tions between residues within a-crystallin domains
[7,8,21,62]. Contrary to other reports, the C-term inal
extension is a lso implicated in oligomerization, but the
exact nature of its role is uncertain.
Small heat shock/a-crystallin proteins confer thermotol-
erance on prokaryotic and eukaryotic organisms
[23,27–33]. The construct used p reviously to examine
induction of thermotolerance by full-length Artemia p26
encoded N -terminal, nonp26 residues, missi ng from the
construct employed h erein [ 49], but the outcome was
similar in each case. Moreover, loss of N-terminal residues
did not drastically change the ability of p 26 to con fer
thermotolerance o n E. coli, suggesting this domain and the
assembly of large oligomers are not required for protection.
In agreement, bacteria transformed w ith Hsp25, and
Hsp25 lacking 33 N-terminal amino-acid residues, are
equally heat tolerant [33]. Removal of C-terminal exten-
sions from C. elegans Hspl6.2, murine Hsp25 and human
aA-crystallin reduced, but did not extinguish small heat
shock/ a-crystallin protein chaperone activity in vitro
[15,16,18], as is true when hydrophobic residues are placed
in the region [17]. Loss of t he C-terminal extension lowered
protein s olubility, con sistent with the notion that this
region is a solubilizing agent [14–17]. E liminating t he
C-terminal extension had little effect on p26 solubility
when bacteria were grown at 30 °Cand37°C, although
testing at higher temperatures may be informative.
Additionally, the C-terminal extension of p26 is required
for full induction of thermotolerance in E. coli and thus
and molecular chaperoning in vitro awaits purification of
truncated p26 derivatives and testing in a defined system,
experiments now in progress.
ACKNOWLEDGEMENTS
The work was supported by a Natural Sciences and E ngineering
Research Co uncil of Canada Re search Grant and a Nova Sc otia
Health Research Foundation New O pportunity Grant to T. H. M.
REFERENCES
1. Bukau, B. & Horwich, A.L. ( 1998 ) The Hsp70 and H sp 60 chap-
erone machines. Cell 92 , 351–366.
2. Wickner, S., Maurizi, M.R. & Gottesman, S. (1999) Posttransla-
tional quality control: fold ing, refolding, and de grading proteins.
Science 286, 1888–1893.
3. Kimmins, S. & MacRae, T.H. (2000) Maturation of steroid
receptors: an example of functional cooperation amo ng m olecular
chaperones and their assoc iat ed proteins. Cell Stress Chaperones 5,
76–86.
4. MacRae, T.H. (2000) Structure and function of small heat shock/
a-crysta llin proteins: es tablish ed concepts and emerging ideas.
Cell. Mol. Life Sci. 57 , 899–913.
5. Easton, D.P., Kaneko, Y . & Subjeck, J.R. ( 2000) The Hsp110 and
Grp170 stress proteins: newly recognized relatives of t he Hsp70s.
Cell Stress Chaperones 5, 276–290.
6. de Jong, W.W., Caspers, G J. & Leunissen, J.A.M. (1998)
Genealogy of the a-crystallinCsmall heat-shock protein super-
family. Int. J. Biol. Macromol. 22, 151–162.
7. Merck, K.B., De Haar d-Hoekman, W.A., Essink, B.B.O.,
Bloemendal, H . & De Jong, W.W. (1992) Expression and aggre-
gation of recombinant aA-crystallin and its two domains. Bi ochim.
Biophys. Acta 1130, 267–276.
Eur. J. Biochem. 267, 1923–1932.
16. Andley, U.P., Mathur, S., Griest, T.A. & Petrash, J.M. (1996)
Cloning, expression, and chaperone-like activity of human
aA-crystallin. J. Biol. Chem. 271, 31973–31980.
17. Smulders, R.H.P.H., Carver, J.A., Lindner, R.A., van Boekel,
M.A.M., B loemendal, H. & de Jong, W.W. (1996) Immobilization
940 J. A. Crack et al.(Eur. J. Biochem. 269) Ó FEBS 2002
of the C-terminal extension of bovine aA-crystallin r educes
chaperone-like activity. J. Biol. Chem. 271, 2 9060–29066.
18. Leroux, M.R., Melki, R., Gordon , B., Bate lier, G. & Candido,
E.P.M. (1997) Structure-function studies on small heat shock
protein oligomeric assembly and interaction with unfolded poly-
peptides. J. Biol. Chem. 272, 24646–24656.
19. van de Klundert, F.A.J.M., Smu lders, R.H.P.H., Gijsen, M.L.J .,
Lindner, R.A., Jaenicke, R., Carver, J.A. & de Jong, W.W.
(1998) The mammalian small heat-shock protein Hsp20 forms
dimers and is a poor chaperone. Eur. J. Biochem. 258, 1014–
1021.
20.Leroux,M.R.,Ma,B.J.,Batelier,G.,Melki,R.&Candido,
E.P.M. (1997) Unique structural features of a novel class of small
heat shock proteins. J. Biol. Chem. 272, 12847–12853.
21. Boelens, W.C., Croes, Y., de Ruwe, M., de Reu, L. & de Jon g,
W.W. (1998) Negative charges in the C-terminal domain
stabilize the aB-crystallin complex. J. Biol. Chem. 273, 28085–
28090.
22. Kokke,B.P.A.,Leroux,M.R.,Candido,E.P.M.,Boelens,W.C.&
de Jong, W.W. (1998) Caenorhabditis elegans small heat-shock
proteins Hsp12.2 and Hsp12.3 f orm tetramers and have no
chaperone-like activity. FEBS Lett. 433, 228–232.
23. Young, L S., Yeh, C H., Chen, Y M. & Lin, C Y. (1999)
& Crabbe, M.J.C. (1998) Effect of mutations of murine lens aB
crystallin on transfected neural cell viability and cellular translo-
cation in response to stress. FEBS Lett. 438, 25–31.
31. Muchowski, P.J. & Clark, J.I. (1998) ATP-enhanced molecular
chaperone functions of t he small heat s hock protein human aB
crystallin. Proc. Natl Acad. Sci. USA 95, 1004–1009.
32. Muchowski, P .J., Wu, G.J.S., Liang, J.J.N., Adman, E.T.
& Clark, J.I. (1999) Site-directed mu tations within the core Ôa-
crystallinÕ domain of the small heat shock protein, human aB-
crystallin, decrease molecular chaperone functions. J. Mol. Biol.
289, 397–411.
33. Guo, Z. & Cooper, L.F. (2000) An N-terminal 33-amino-acid-
deletion variant of hsp25 retains oligomerization a nd functional
properties. Biochem. Biophys. Res. Comm. 270, 183–189.
34. Andley, U.P., Song, Z., Wawrousek, E.F., Fleming, T.P. &
Bassnett, S. (2000) Differential protective activity of aA- and
aB-crystallin in lens epithelial cells. J. Biol. Chem. 275, 36823–
36831.
35. Samali, A., Robertson, J.D., Peterson, E., Manero, F., van Zeijl,
L., Paul, C., Cotgreave, I.A., Arrigo, A P. & Orrenius, S. (2001)
Hsp27 protects m itochondria of thermotolerant cells aga inst
apoptotic stimuli. Cell Stress Chaperones 6, 49–58.
36. Rajaraman, K., Raman, B. & Rao, ChM. (1996) Molten-globule
state of carbonic anhydrase binds to the chaperone-like a-crys-
tallin. J. Biol. Chem. 271, 27595–27600.
37. Sun, T X., Das, B.K. & Liang, J.J N. (1997) Conformational and
functional differences b etween recombinant human len s aA- and
aB-crystallin. J. Biol. Chem. 272, 6220–6225.
38. Wang, K. & S pector, A. (2000) a-Crystallin prevents irreversible
protein d en aturat ion and acts co op eratively with other heat-shock
undergoing thermal stress. J. Bio l. Chem. 275, 32559–32565.
47. Jackson, S.A. & Clegg, J.S. (1996) Ontogeny of low molecular
weight stress protein p26 during early development of the brine
shrimp, Artemia franciscana . Dev. Growth Differ. 38, 153–160.
48. Clegg, J.S., Willsie, J.K. & Jackson, S.A. ( 1999) Adaptive signifi-
canceofasmallheatshock/a-crystallin protein (p26) in encysted
embryos of the brine s hrimp, Artemia franciscana. Am. Zool. 39,
836–847.
49. Liang, P. & MacRae, T.H. (1999) The synthesis of a small heat
shock/a-crystallin protein in Artemia and its relationship to stress
tolerance during development. Dev. Biol. 207, 445–456.
50. MacRae, T.H. (2001) Do stress proteins protect embryos during
metabolic arrest and diapause? I n Molecular Mechanisms o f
Metabolic Arre st. Life in Limbo (Storey, K.B., ed.), pp. 169–186.
BIOS Scientific Publishers Ltd., Oxford, UK
51. Clegg, J.S. (1997) Embryos of Artem ia franciscana su rvi ve four
years o f continuous a noxia: the c ase for comple te metabolic rate
depression. J. Exp. Biol. 200 , 467–475.
52. Clegg, J .S. & Jackson, S.A. ( 1998) The metabolic status of qui-
escent and diapause embryos of Artemia franciscana (Kellogg).
Arch. Hydrobiol. 52, 425–439.
53. Drinkwater, L.E. & Clegg, J.S. (1991) Experimental biology of
cyst diapause. In Artemia Biology (Browne,R.A.,Sorgeloos,P.&
Trotman, C.N.A., eds), pp. 93–117. CRC P ress, I nc., Boca Raton,
FL.
Ó FEBS 2002 Small heat shock/a-crystallin protein from Artemia (Eur. J. Biochem. 269) 941
54. Clegg, J.S., Jackson, S .A. & Po pov, V.I. (2000) Long-term anoxia
in encysted embryos o f the c rusta cean, Artemia franciscana: v iabil-
ity, ultrastructure and stress proteins. Cell Tiss . R es. 301, 4 33–446.
55. Warner, A.H. & Clegg, J.S. (2001) Diguanosine nucleotide me-
dal, H. & de Jong, W.W. (1995) Reduced chaperone-like activity
of aA
ins
-crystallin, an alternative splicing product containing a
large insert peptide. J. Biol. Chem. 270, 13916–13924.
65. Cobb, B.A. & Petrash, J.M. (2000) Struct ural and functional
changes in the aA-crystallin R116C mutant in hereditary cata-
racts. Biochemistry 39, 15791–15798.
66. Haslbeck,M.,Walke,S.,Stromer,T.,Ehrnsperger,M.,White,
H.E., Chen, S., Saibil, H.R. & Buchner, J. ( 1999) Hsp26: a tem-
perature-regulated chaperone. EMBO J. 18 , 6744–6751.
67. Koteiche, H.A. & Mchaourab, H.S. (1999) Folding pattern of the
a-crystallin domain in aA-crystallin determined by site-directed
spin labelling. J. Mol. B iol. 294, 561–577.
68. To
¨
ro
¨
k, Z., Goloubinoff, P., Horva
´
th, I., Tsvetkova, N.M., Glatz,
A.,Balogh,G.,Varvasovszki,V.,Los,D.A.,Vierling,E.,Crowe,
J.H. & Vigh, L. (2001) Synechocystis HSP17 is an a mphitropic
protein that stabilizes heat-stressed membranes and binds dena-
tured proteins for su bsequent chaperone-mediated refolding. Proc.
Natl Acad. Sci. USA 98, 3098–3103.
942 J. A. Crack et al.(Eur. J. Biochem. 269) Ó FEBS 2002