Interaction of Sesbania mosaic virus movement protein
with the coat protein – implications for viral spread
Soumya Roy Chowdhury and Handanahal Subbarao Savithri
Department of Biochemistry, Indian Institute of Science, Bangalore, India
Introduction
Plants have an elaborate communication system that
permits transport of macromolecules from one cell to
another. Plant viruses have evolved mechanisms to
manipulate the same resident communication system
and redirect it in such a way that the viral genome is
transported from one cell to another, leading to spread
of infection. The virus-encoded movement protein
(MP), in association with other viral and host factors
called ancillary proteins, plays a central role in this
process. The MP–genome complex, or, in some cases,
assembled virus particles, interacts with the compo-
nents of plasmodesmata and dilates the openings to
permit passage through the cell wall [1,2]. Although
MPs are not conserved across genera, they perform
similar functions [3]. In terms of the nature of the
nucleoprotein complex that moves from cell to cell,
plant viruses may be broadly divided into two types
[4]. In the first type, MPs interact with viral RNA to
form a movement complex (M complex), which is
transported from cell to cell, as in tobacco mosaic
Keywords
coat protein; protein–protein interaction;
recombinant movement protein;
sobemovirus
Correspondence
H. S. Savithri, Department of Biochemistry,
MINT-8050226: MP (uniprotkb:Q9EB09) physically interacts (MI:0915) with CP (uni-
protkb:
Q9EB06)bytwo hybrid (MI:0018)
Abbreviations
CP, coat protein; CPMV, cowpea mosaic virus; GnHCl, guanidine hydrochloride; GST–MP, recombinant MP expressed in E. coli with an
N-terminal glutathione sulfur transferase tag; NV, native virus; M complex, movement complex formed by MP with viral genomic RNA;
MP, movement protein; rMP, recombinant MP expressed in E. coli with an N-terminal histidine tag; SBMV, Southern bean mosaic virus;
SeMV, Sesbania mosaic virus; TMV, tobacco mosaic virus; Y2H, yeast two-hybrid.
FEBS Journal 278 (2011) 257–272 ª 2010 The Authors Journal compilation ª 2010 FEBS 257
virus (TMV). TMV has been shown to be transported
as a replication complex that contains MP, viral repli-
case and genomic RNA [5]. In the second type, intact
virus particles are transported through MP-containing
tubules, as observed in cowpea mosaic virus (CPMV)
[6]. However, MPs that are known to form an M com-
plex can also form tubules [7], and MPs that form
tubules can also bind to RNA [8,9].
An extensive analysis of the function of MPs of
viruses from various genera has shown that taxonomi-
cally different viruses may use the same strategy, while
closely related viruses may use different strategies, and
some may use more than one strategy for the spread
of infection [3]. It is also possible that viruses may use
different strategies depending on the host they infect
[10]. The mechanism of virus movement is therefore
diverse and complex, involving several factors [11].
Sobemoviruses are plant RNA viruses that are
named after their type species, Southern bean mosaic
virus (SBMV). Viruses belonging to this genus are ico-
sahedral particles of approximately 30 nm in diameter.
sobemoviruses has not been investigated. Other virus-
encoded ancillary proteins that may interact with
sobemoviral MPs and assist in cell-to-cell or systemic
movement of the virus have not yet been identified. It
is not known whether sobemoviruses use TMV-type or
CPMV-type movement strategies. Functional charac-
terization of sobemoviral MPs and understanding of
the role of ancillary proteins ⁄ domains in cell-to-cell
movement may assist in identification of genome seg-
ments that could be targeted for developing antiviral
strategies for this particular virus group.
Sesbania mosaic virus (SeMV) belongs to the Sob-
emovirus genus, and was first identified from infected
Sesbania grandiflora pers agathi on farms around
Tirupati, Andhra Pradesh, India. The 3D structure of
the purified virus has been determined, and it was
shown to be an icosahedral virus with a diameter of
30 nm comprising 180 identical CP subunits [19,20].
The SeMV genome is 4149 nucleotides long, and
encodes four potential overlapping ORFs [21]. Com-
parison of the nucleotide and the deduced amino acid
sequences of SeMV ORFs with those of other sobem-
oviruses revealed that SeMV is closest to the South-
ern bean mosaic virus Arkansas isolate (SBMV-Ark)
[21]. The mechanisms of SeMV assembly and poly-
protein processing have been reported previously
[22–25].
In the present study, the ORF1 gene encoding the
SeMV MP was cloned and over-expressed in Escheri-
chia coli in fusion with a hexahistidine or a glutathione
tein server ( [26]. As
shown in Fig. 1, the SeMV MP was predicted to be a
primarily a-helical protein. The predicted percentages
of a helix, b sheet and coil were 49%, 25% and 26%,
respectively. The potential involvement of post-transla-
tional modification of viral MPs in regulation of their
transport mechanism was first suggested in view of
finding that the 30 kDa MP of TMV is phosphorylated
within host cells. Other viral MPs, such as those of
tomato mosaic virus and potato leafroll virus, were sub-
sequently also shown to be phosphorylated during the
infection process [27,28]. One consequence of the phos-
phorylation event on MP is that it could result in the
unloading of the viral genome from the M complex
after it enters the neighbouring cell through plasmodes-
mata [29–31]. However, other reasons for phosphoryla-
tion of MPs could also exist that have yet to be
identified. Nevertheless, the fact remains that MPs are
sometimes post-translationally modified by phosphory-
lation. Therefore, a search for the presence of potential
phosphorylation sites in the SeMV MP was performed
using the netphos 2.0 server ( />services/NetPhos/). RNA binding sites and other motifs
were searched using the Block search program (http://
blocks.fhcrc.org/blocks/blocks_search.html). The results
suggested the presence of a nucleic acid binding domain
in the C-terminal segment of the SeMV MP (Fig. 1,
grey box) and a high density of predicted phosphoryla-
tion sites at the C-terminus of the protein (Fig. 1,
yellow box). However, no conserved motif was found
when the SeMV MP sequence was compared with other
mosaic virus
17.8 27.5
Lucerne transient streak
virus
17.1 32.6
Rice yellow mottle virus 9.1 12.3
Cocksfoot mottle virus 8 15.1
Tobamovirus Tobacco mosaic virus 11 19.9
Alfamovirus Cowpea chlorotic mottle
virus
11.5 19.3
Alfalfa mosaic virus 8 14.7
Cucumovirus Cucumber mosaic virus 9.8 17.6
Comovirus Cowpea mosaic virus 4.7 6.9
Bromovirus Brome mosaic virus 2.7 6.1
Fig. 1. Prediction of the secondary structure of the SeMV MP. S,
sequence; P, secondary structure predicted using the PredictPro-
tein server ( The grey boxes repre-
sents the RNA binding motif. The red boxes indicate cysteine
residues and the yellow box indicates a high-propensity phos-
phorylation site predicted by the NetPhos 2.0 server (http://www.
cbs.dtu.dk/services/NetPhos/).
S. R. Chowdhury and H. S. Savithri Interaction of SeMV MP with viral coat protein
FEBS Journal 278 (2011) 257–272 ª 2010 The Authors Journal compilation ª 2010 FEBS 259
Circular dichroism (CD) spectroscopy
The far-UV CD spectrum of the purified and refolded
rMP showed minima at 210 and 222 nm, suggesting
that the protein was folded and adopted a largely
a-helical conformation (Fig. 3A). Analysis of the CD
spectrum using K2D2 software ( />projects/k2d2/) showed that rMP comprises more than
fied ELISA was performed as described in Experimen-
tal procedures. ELISA plates were coated with NV,
blocked, and rMP was added. The interaction between
the two proteins was monitored by using antibodies
against rMP (Fig. 4A). In a reverse experiment, rMP
was immobilized on ELISA platea and NV was used
as the probe protein (Fig. 4B). In both the experi-
ments, BSA was used as a control. Cross-reaction of
the primary antibody to the immobilized protein was
also tested by ELISA in the absence of the interacting
proteins. rMP interacted with NV in both the experi-
ments (Fig. 4A,B).
Nature of the MP–NV interaction
To determine the concentration dependence and nature
of the interaction between MP and NV, the same
ELISA-based approach was used. ELISA plates were
coated with NV (5 l g), and, after blocking, increasing
AB C
Fig. 2. Expression, solubility analysis and purification of rMP. (A) The pRSET C-MP clone was transformed into E. coli BL21 (DE3) cells. The
total lysate after isopropyl-b-
D-thiogalactopyranoside induction was analysed by 12% SDS ⁄ PAGE. Lanes U and I correspond to uninduced
and induced total lysate, respectively. The arrow indicates the position of the rMP band in the induced sample (lane I). (B) SDS ⁄ PAGE (12%)
of soluble (S) and pellet (P) fractions of rMP-expressing cells. The arrow indicates the position of the rMP band. (C) SDS ⁄ PAGE (12%) show-
ing rMP purified by Ni-NTA affinity chromatography under denaturing conditions using 6
M GnHCl (lanes 1 and 2). The arrow indicates the
position of purified protein. Lane M, protein molecular mass markers. The gels were stained with Coomassie brilliant blue R250.
Interaction of SeMV MP with viral coat protein S. R. Chowdhury and H. S. Savithri
260 FEBS Journal 278 (2011) 257–272 ª 2010 The Authors Journal compilation ª 2010 FEBS
concentrations of rMP were added, and the ELISA
was performed. The absorbance at 450 nm was plotted
M urea (dotted line). The emission maximum
showed a red shift to 365 nm upon addition of 8
M urea, and a
broad peak between 305 and 315 nm was also observed due to
emission by tyrosine residues that are exposed in the protein in the
denatured state.
A
B
Fig. 4. Interaction of rMP with NV. (A) ELISA of rMP and NV inter-
action. ELISA plates coated with NV (5 lg) (P1) were blocked with
10% skimmed milk in 1% NaCl ⁄ Pi (block) followed by addition of
5 lg of rMP (P2). The ELISA was performed using an anti-MP poly-
clonal antibody (pAb to P2) and developed using anti-rabbit IgG con-
jugated to horseradish peroxidise and DMB H
2
O
2
(sAb + Sub). The
steps involved and the controls used are indicated on the figure.
BSA was used as a negative control. (B) Reverse experiment in
which ELISA plates were coated with rMP (P1) and probed with
NV (P2). Primary polyclonal antibodies against NV (pAb to P2) were
used in this reaction, with controls similar to those used in (A).
S. R. Chowdhury and H. S. Savithri Interaction of SeMV MP with viral coat protein
FEBS Journal 278 (2011) 257–272 ª 2010 The Authors Journal compilation ª 2010 FEBS 261
buffer in which rMP was dissolved. The optimal pH
for interaction between the two proteins was between
pH 6.5 and 7.5, with a sharp decrease in both the
acidic and alkaline ranges. These observations suggest
that the interaction between the two proteins is opti-
trations of rMP after a blocking step. The absorbance values
obtained at 450 nm by ELISA with anti-MP polyclonal antibody were
plotted as a function of rMP concentration. (B) Effect of pH on the
NV–MP interaction. ELISA plates coated with NV (P1) were incu-
bated with rMP (P2) in 50 m
M buffers at various pH as indicated in
the figure. After incubation, the wells were washed, ELISA was
performed using anti-MP polyclonal antibody (pAb to P2), and
absorbance values at 450 nm were plotted as a function of pH. rMP
in NaCl ⁄ Pi (pH 7.4) was used as a positive control. The other controls
used are indicated in the figure. (C) Effect of NaCl on the NV–MP
interaction. ELISA plates coated with NV (P1) were blocked with
10% skimmed milk in PBS and incubated with rMP (P2) dissolved in
50 m
M Tris ⁄ HCl buffer (pH 7.4) containing various concentrations of
NaCl as shown in the figure and incubated for 1 h. After extensive
washing of the wells, ELISA was performed as described in
Experimental procedures using anti-MP polyclonal antibody (pAb to
P2). The absorbance values obtained at 450 nm were plotted as a
function of NaCl concentration.
Interaction of SeMV MP with viral coat protein S. R. Chowdhury and H. S. Savithri
262 FEBS Journal 278 (2011) 257–272 ª 2010 The Authors Journal compilation ª 2010 FEBS
ELISA and GST pull-down experiments were per-
formed as described previously. GST–MP was found
to interact with NV both in ELISA (Fig. 6B) and pull-
down assays (data not shown). To rule out the possi-
bility that the interaction between GST–MP and NV is
due to interaction between GST and NV, a GST
blocking step was introduced in the ELISA-based
interaction assay (Fig. 6B, last two columns). There
NV (5 lg) and blocked with 10% milk in NaCl ⁄ P
i
,
followed by addition of various mutants as probe pro-
teins. The ELISA was performed using anti-rMP as
the primary antibody. In parallel, subsequent wells
were incubated with GST and probed using polyclonal
antibodies against GST to rule out the possibility of
GST–NV interaction. Determination of the absor-
bance at 450 nm clearly showed that the N-terminal
deletions have a pronounced effect on MP–NV inter-
action. Successive deletion of one, two and three pre-
dicted helices from the N-terminus of MP reduced the
interaction with NV by 51.5%, 66.4% and 80.1%,
respectively, compared with the interaction between
GST–MP and NV. However, the interaction was not
affected when C-terminal amino acids were deleted. It
may therefore be concluded that MP interacts with
NV via the N-terminal domains. Similar observations
were also made in pull-down experiments (data not
shown).
A
B
Fig. 6. Purification of GST–MP, and determination of the interac-
tion between GST–MP and NV by ELISA. (A) Coomassie brilliant
blue-stained 12% SDS ⁄ PAGE gel showing GST–MP and GST puri-
fied by glutathione affinity chromatography. Lanes are marked as
unbound protein (U), washed samples (W), eluted GST–MP (E) and
purified GST (G). Lane M, protein molecular mass markers. Arrows
indicate the position of purified proteins. (B) Protein–protein interac-
and strength of interaction between the SeMV MP or
the deletion mutants and CP (Fig. 8A,B).
AH109 cells co-transformed with pGBK T7 MP and
pGAD T7 CP grew on all nutritional selection medium
up to the final level of selection (–Leu ⁄ –Trp ⁄ –His ⁄
–Ade ⁄ +a-X-Gal), similar to the positive control com-
prising p53 and T-Ag (first two rows from the top in
Fig. 8A,B), suggesting that MP and CP also interact
with each other under the ex vivo conditions of Y2H
system. However, the AH109 strain transformed with
either the pGAD T7 MP clone or the pGBK T7 CP
clone alone did not form colonies, ruling out the possi-
bility of de novo activation of the reporter gene in the
presence of the expressed proteins. Similarly, untrans-
formed AH109 S. cerevisiae alone did not form any
colonies (data not shown).
To identify the domain in MP that is involved in
interaction with CP, MP mutant gene products
obtained by PCR were cloned into the pGBK T7 vec-
tor, and the mutants were tested for their interaction
with CP expressed from the pGAD T7 vector. Fig. 8
shows that all the mutants exhibited positive Y2H
interaction with CP. The interaction between ND16
and CP (third row from top, Fig. 8) was observed for
growth under medium stringency conditions (–Leu ⁄ –
Trp ⁄ –His ⁄ +a-X-Gal), but no interaction was observed
under high stringency conditions (–Leu ⁄ –Trp ⁄ –His ⁄
–
Ade). For ND35 (fourth row from top in Fig. 8A,B),
the level of interaction was comparable to that
Fig. 8) had a minimal effect on the interaction between
MP and CP. However, none of the deletion mutants
grew on –Leu ⁄ –Trp ⁄ –His ⁄ –Ade plates, indicating that
there was some loss of interaction (rows 3–8, column
5, in Fig. 8A,B) .
b-galactosidase assay with ortho-nitrophenyl-b-
galactopyranoside as substrate
Transformed colonies that showed a positive Y2H
interaction were grown in liquid culture (–Leu ⁄ –Trp ⁄ –
His medium), and were assayed for b-galactosidase
activity to validate and quantify the results of the two-
hybrid interactions. A single colony was picked from
each of the SD plates, and the b-galactosidase assay
was performed as described in Experimental proce-
dures. The results are presented as a percentage of
arbitrary units of b-galactosidase activity (values indi-
cated on the top of each bar) relative to that obtained
with transformants expressing p53 and T-antigen
(100%). Values are the means of at least three separate
experiments (Fig. 9A). There was no difference in the
b-galactosidase activity between transformants express-
ing CP with MP, ND16, CD3, CD19 or CD38. How-
ever, an appreciable decrease in activity was seen in
transformants expressing CP with ND35 or ND49.
Interaction between the SeMV MP and CP resulted in
71% activity compared with the interaction between
p53 and the T-antigen (100%). The interaction
between the DN49 mutant MP and CP resulted in
27% activity. This corresponds to a reduction in activ-
ity of 60% compared with interaction of the wild-type
SeMV, a member of the genus Sobemovirus. Analysis
of the deduced amino acid sequence of the SeMV MP
showed that it is predominantly an a-helical protein. It
has a C-terminal nucleic acid binding domain and a
predicted phosphorylation site as expected of a protein
involved in viral movement (Fig. 1).
The interaction between MPs and virus- or host-
encoded ancillary proteins is important for transport
of the viral genome from one cell to another. The
results presented here clearly show that the purified
SeMV MP interacts with NV and CP, suggesting that
SeMV might belong to the class of viruses that require
MP and NV ⁄ CP for cell-to-cell movement.
An inherent characteristic of MPs is their ability to
interact with plasmodesmata and components of the
cellular vasculature. Hence, they tend to form inclusion
bodies when expressed in vitro [36–38]. The rMP over-
expressed in E. coli was also present in the insoluble
fraction and was purified under denaturing conditions
(Fig. 2), but could be successfully refolded. Upon
denaturation with 8 m urea, in addition to the shift of
the fluorescence emission maxima from 345 to 365 nm
due to exposure of tryptophan residues, an additional
broad peak at 305–315 nm was observed. There is a
single tryptophan (position 84) and eight tyrosines in
the SeMV MP. It is possible that the fluorescence
emission of these tyrosines is quenched by energy
transfer to tryptophan or charged amino groups or
protonated carboxylates in their vicinity in the refolded
protein. However, upon denaturation, fluorescence due
antigen-coating ELISA for estimation of the interaction between CP
and MP or its deletion mutants. Total protein isolated from AH109
cells transformed with pGBK T7 MP or MP deletion clones and
pGAD T7 CP was coated on to ELISA plates. The amount of MP
and the deletion mutants was quantified using cMyc monoclonal
antibody (open bars). The amount of CP was estimated using hae-
magglutinin polyclonal antibody (closed bars).
Interaction of SeMV MP with viral coat protein S. R. Chowdhury and H. S. Savithri
266 FEBS Journal 278 (2011) 257–272 ª 2010 The Authors Journal compilation ª 2010 FEBS
be available for interaction with MP. However, the
ELISA results unambiguously demonstrated that rMP
and NV interact with each other.
An insight into the nature of interaction between the
rMP and NV was obtained by monitoring the effect of
pH and NaCl concentration (Fig. 5B,C). The forma-
tion of salt bridges and hydrogen bonds crucial for
protein–protein interactions is dependent on pH. Vari-
ation in pH may also lead to conformational changes
that may hinder interactions. The interaction between
rMP and NV was optimal near physiological pH, sug-
gesting that these interactions might be relevant for
in vivo functions of MP. It is likely that the interaction
between the two proteins is largely ionic, as rMP and
CP have opposite computed net charges ()4.8 and
+13.3, respectively). High ionic strength can reduce
such interactions due to shielding of ionizable groups.
However, the interaction between the proteins was
unaffected when rMP was allowed to bind to immobi-
lized NV in the presence of 1 m NaCl, suggesting that
the interaction between the two proteins is quite strong
important implications for the plant virus lifecycle.
The interaction between MP and CP must be transient.
The M complex must disassemble once the genome is
translocated to an adjacent cell so that further steps in
the lifecycle, i.e. replication of the viral genome, may
proceed. Dissociation of viral genome from the com-
plex has been attributed to phosphorylation of MP
[44].
Similar to the in vitro results, deletion of amino
acids from the N-terminus resulted in a decreased
interaction between MP and CP in Y2H assays. Dele-
tion of the N-terminal 16 amino acids or the C-termi-
nal 3, 19 and 38 amino acids had a marginal effect.
However, deletion of 35 amino acids from the N-ter-
minus (first two helices) reduced the interaction by
50%, and deletion of 49 amino acids (first three heli-
ces) reduced the interaction by 60% as monitored by
measuring the b-galactosidase activity (Fig. 9A), sug-
gesting that the location of the interacting domain is
between residues 17 and 49. Further, it should be
noted that there was no a-galactosidase activity on SD
plates (Fig. 8A, total absence of blue colonies in –
Leu ⁄ –Trp ⁄ –His ⁄ +a-X-Gal plates) for the interaction
between CP and the deletion mutant DN49. However,
the colonies grew in –Leu ⁄ –Trp ⁄ –His plates, demon-
strating that a degree of interaction between the pro-
teins remains. It is possible that another site of
interaction beyond the N-terminal 49 residues may
contribute to these weak interactions.
In conclusion, the results presented here clearly dem-
pRSET C-MP clone resulted in a protein with additional
16 amino acids at the N-terminus, including the hexahisti-
dine tag, due to the cloning strategy used. In order to
express MP as an N-terminally GST-tagged protein, the
PCR product was cloned into the EcoRI site of the
pGEX 4T1 vector (GE Healthcare, Uppsala, Sweden). The
identity of both clones was confirmed by PCR using T7
sense and MP antisense primers (Table 1) and DNA
sequencing.
Construction of GST–MP deletion mutant clones
MP deletion mutant genes were amplified separately using
high-fidelity fusion polymerase, with sense and antisense
primers (marked with the prefix E, Table 2) corresponding
to the N- and C-termini for each deletion mutant protein
and the pGEX 4T1 MP clone as the template. The PCR
products were cloned into the EcoRI site of the pGEX 4T1
vector. The identity of all clones was confirmed by PCR
using T7 sense and mutant specific antisense primers
(Table 2) and DNA sequencing.
Expression and purification of the recombinant
proteins under normal and denaturing conditions
The pRSET C-MP clone and the pGEX 4T1-MP clone were
transformed separately into E. coli BL21(DE3) pLysS cells
(Novagen, Darmstadt, Germany). A single colony was inoc-
ulated into 20 mL of Luria–Bertani medium containing
50 lgÆmL
)1
ampicillin, and allowed to grow overnight at
37 °C. The overnight culture was inoculated into 500 mL of
Terrific broth containing 50 lgÆmL
dialysis against lysis buffer (not containing imidazole) with
decreasing concentrations of GnHCl (6, 4, 2, 1 and 0 m), and
stored at 4 °C. The refolded rMP was us ed to raise antibod-
ies in rabbit as described previously [22].
Table 2. Oligonucleotide primers used in the study.
Name Sequence (5¢fi3¢) Description
MP sense
MP anti
CCG
GCTAGCG
GAATTC
ATGATGGTAATGCAAGCTCAGCATACT
CCGG
GAATTC
GGAGGAGGACATAGCCCT
Primers for amplification of the MP gene. The EcoRI site is
indicated in bold and the NheI site is underlined.
E.CP sense
E.CP anti
CCG
CATATGG
GAATTC
ATGATGGCGAAAAGGCTTTCG
CCG
CATATGG
GAATTC
GTTGTTCAGGGCTGAGGC
Primers for amplification of the CP gene. The EcoRI site is
indicated in bold and the NdeI site is underlined
E.MP.N35 sense CCG
was added to the soluble fraction of the cell lysate obtained
as described above and incubated for 2 h at 4 °C. The resin
was packed in a column and washed thoroughly with wash
buffer (20 m m Tris ⁄ HCl pH 7.5 containing 200 mm NaCl,
10 mm imidazole, 0.1% Nonidet-P40 ((Sigma-Aldrich,
St Louis, MO, USA) and 10 mm b-mercaptoethanol). The
bound protein was eluted using 20 mm reduced glutathione
in wash buffer. The purified proteins were extensively dialy-
sed against storage buffer (50 mm Tris ⁄ HCl, pH 8, contain-
ing 100 mm NaCl, 10 mm b-mercaptoethanol and 10%
glycerol0 to remove the reduced glutathione, and stored at
)20 °C. The same procedure was used for the purification
of GST–MP deletion mutants.
CD spectroscopy
CD spectra were recorded using a Jasco-815 spectropola-
rimeter (Jasco Analytical Instruments, Easton, MD, USA).
The molar ellipticity was monitored from 190 to 250 nm
using 0.5 mgÆmL
)1
protein in a 0.2 cm path-length cuvette
with a bandwidth of 1 nm and response time of 1 s. All
spectra were corrected using respective buffer controls. The
stability of the protein was monitored by CD spectroscopy
in a PTC-423S Peltier thermal control system (Jasco), by
observing the change in the molar ellipticity at 210 nm due
to loss of secondary structure with increase in temperature.
The temperature was increased at a rate of 1 °CÆmin
)1
, and
the ellipticity was monitored from 20–100 °C. The melting
quently centrifuged at 100 g for 60 s to pellet the bound
protein with the resin. The supernatant was discarded. The
pellet fraction was washed five times for 5 min each using
1 mL each of buffer W1 (20 mm Tris ⁄ HCl, 100 mm NaCl,
5mm imidazole, pH 8), buffer W2 (20 mm Tris ⁄ HCl,
200 mm NaCl, 10 mm imidazole, pH 8) and buffer W3
(20 mm Tris ⁄ HCl, 200 mm NaCl, 15 mm imidazole, pH 8).
Finally, the bound proteins were eluted using elution buffer
(20 mm Tris ⁄ HCl, 200 mm NaCl, 250 mm imidazole, pH 8).
The eluate, together with 50 lL aliquots of unbound and
wash fractions, were separated by SDS ⁄ PAGE followed by
silver staining to check for the presence of proteins.
The interaction between MP, MP mutants and NV was
also tested by ELISA as described previously with minor
modifications [46–49]. The wells of the ELISA plate (F8
Nunc Maxisorp loose, Nunc, Roskilde, Denmark) were
coated with 5.0 lg of first protein (100 lL per well) at
37 °C for 2 h. The protein was diluted with 1· NaCl ⁄ P
i
(pH 7.4). The unadsorbed protein was removed, and the
wells were blocked with 10% skimmed milk in 1· NaCl ⁄ P
i
for 1 h at 37 °C. The plates were then incubated with the
second protein for 2 h at 37 °C. BSA was used as a control.
The wells were washed three times for 3 min each with 1·
NaCl ⁄ P
i
containing 0.05% Triton X-100, and then three
times with 1· NaCl ⁄ P
i
(Clontech Laboratories Inc., Mountain View, CA, USA),
S. R. Chowdhury and H. S. Savithri Interaction of SeMV MP with viral coat protein
FEBS Journal 278 (2011) 257–272 ª 2010 The Authors Journal compilation ª 2010 FEBS 269
conferring HIS3, ADE2, MEL1 and lacZ reporters and
allowing high-stringency assay s. For ba it and pr ey construc-
tion, the oligodeoxynucleotide primers shown in Table 2
(marked with prefix E) were used for PCR amplification of
MP, MP deletion mutant and CP genes. Amplicons were
sub-cloned into the EcoRI site of pGBKT7 (MP, ND16, ND35,
ND49, CD3, CD19 and CD38) and pGADT7 (CP) vectors.
The yeast strains were transformed with the constructs,
and colonies were grown according to the Clontech Yeast
Protocols Handbook (Protocol No. PT3024-1. 4. Version
No. PR973283, Clontech www.clontech.com/images/pt/
PT3024-1.pdf). Plasmid selection within yeast cells were
maintained by growing cells in minimal medium (0.67%
yeast nitrogen base, 2% glucose) with appropriate omission
of amino acids (–Leu and –Trp for yeast transformed with
both bait and prey plasmids). Replica plating was per-
formed under conditions of increasing stringency according
to the manufacturer’s suggestions, whereby interacting pro-
teins were sequentially analysed for growth on nutritional
selection plates containing –Leu ⁄ –His ⁄ –Trp or –Ade ⁄ –
Leu ⁄ –His ⁄ –Trp, with or without 5-bromo-4-chloro-3-indol-
yl-a-d-galactopyranoside (a-X-Gal) to monitor MEL1
reporter construct expression directly. Images were captured
after 4–6 days of growth at 30 °C. AH109 yeast cells trans-
formed with pGBKT7-P53 (murine p53 fused to GAL4
DNA BD) and pGADT7-T Ag (SV40 large T-antigen fused
to GAL4 DNA AD) that had previously been reported to
We thank Professor N. Appaji Rao and Professor
M.R.N. Murthy (Molecular biophysics unit, Indian
Institute of Science) for valuable discussions. We thank
the Department of Biotechnology and the Department
of Science and Technology, New Delhi, India, and the
Indian Institute of Science, Bangalore, India, for finan-
cial support. S.R.C. thanks the University Grant Com-
mission, New Delhi, India, for the senior research
fellowship.
References
1 Waigmann E, Lucas WJ, Citovsky V & Zambryski P
(1994) Direct functional assay for tobacco mosaic virus
cell-to-cell movement protein and identification of a
domain involved in increasing plasmodesmal permeabil-
ity. Proc Natl Acad Sci USA 91, 1433–1437.
2 Lazarowitz SG (1999) Probing plant cell structure and
function with viral movement proteins. Curr Opin Plant
Biol 2, 332–338.
3 Scholthof HB (2005) Plant virus transport: motions of
functional equivalence. Trends Plant Sci 10, 376–382.
4 Carrington JC, Kasschau KD, Mahajan SK & Schaad
MC (1996) Cell-to-cell and long-distance transport of
viruses in plants. Plant Cell 8, 1669–1681.
5 Kawakami S, Watanabe Y & Beachy RN (2004)
Tobacco mosaic virus infection spreads cell to cell as
intact replication complexes. Proc Natl Acad Sci USA
101, 6291–6296.
6 Kasteel D, Wellink J, Verver J, van Lent J, Goldbach R
& van Kammen A (1993) The involvement of cowpea
mosaic virus M RNA-encoded proteins in tubule forma-
Fauquet C (1998) Expression of the rice yellow mottle
virus P1 protein in vitro and in vivo and its involvement
in virus spread. Virology 244, 79–86.
15 Sivakumaran K, Fowler BC & Hacker DL (1998)
Identification of viral genes required for cell-to-cell
movement of southern bean mosaic virus. Virology 252,
376–386.
16 Meier M, Paves H, Olspert A, Tamm T & Truve E
(2006) P1 protein of Cocksfoot mottle virus is indis-
pensable for the systemic spread of the virus. Virus
Genes 32, 321–326.
17 Voinnet O, Pinto YM & Baulcombe DC (1999) Sup-
pression of gene silencing: a general strategy used by
diverse DNA and RNA viruses of plants. Proc Natl
Acad Sci USA 96, 14147–14152.
18 Sarmiento C, Gomez E, Meier M, Kavanagh TA &
Truve E (2007) Cocksfoot mottle virus P1 suppresses
RNA silencing in Nicotiana benthamiana and Nicotiana
tabacum. Virus Res 123, 95–99.
19 Bhuvaneshwari M, Subramanya HS, Gopinath K,
Savithri HS, Nayudu MV & Murthy MR (1995) Struc-
ture of sesbania mosaic virus at 3 A
˚
resolution. Structure
3, 1021–1030.
20 Subramanya HS, Gopinath K, Nayudu MV,
Savithri HS & Murthy MR (1993) Structure of Sesbania
mosaic virus at 4.7 A
˚
resolution and partial sequence
phosphorylated by a membrane-associated protein
kinase from potato with biochemical features of protein
kinase C. FEBS Lett 400, 201–205.
29 Rhee Y, Tzfira T, Chen MH, Waigmann E &
Citovsky V (2000) Cell-to-cell movement of tobacco
mosaic virus: enigmas and explanations. Mol Plant
Pathol 1, 33–39.
30 Matsushita Y, Hanazawa K, Yoshioka K, Oguchi T,
Kawakami S, Watanabe Y, Nishiguchi M & Nyunoya
H (2000) In vitro phosphorylation of the movement
protein of tomato mosaic tobamovirus by a cellular
kinase. J Gen Virol 81, 2095–2102.
31 Waigmann E, Chen MH, Bachmaier R, Ghoshroy S &
Citovsky V (2000) Regulation of plasmodesmal trans-
port by phosphorylation of tobacco mosaic virus
cell-to-cell movement protein. EMBO J 19,
4875–4884.
32 Ruan K, Li J, Liang R, Xu C, Yu Y, Lange R &
Balny C (2002) A rare protein fluorescence behavior
where the emission is dominated by tyrosine: case of
the 33-kDa protein from spinach photosystem II.
Biochem Biophys Res Commun 293, 593–597.
33 Lokesh GL (2002) Molecular insight into the genome
organization and assembly of Sesbania mosaic virus. PhD
thesis, Indian Institute of Science, Bangalore, India.
34 Chowdhury SR (2010) Molecular characterization of
movement protein encoded by ORF 1 of Sesbania mosaic
virus. PhD thesis, Indian Institute of Science, Bangalore,
India.
35 Li B & Fields S (1993) Identification of mutations in
Goldbach R (1991) Tubular structures involved in
movement of cowpea mosaic virus are also formed in
infected cowpea protoplasts. J Gen Virol 72, 2615–2623.
43 Kumar PP, Usha R, Zrachya A, Levy Y, Spanov H &
Gafni Y (2006) Protein–protein interactions and nuclear
trafficking of coat protein and bC1 protein associated
with Bhendi yellow vein mosaic disease. Virus Res 122,
127–136.
44 Lee JY & Lucas WJ (2001) Phosphorylation of viral
movement proteins – regulation of cell-to-cell traffick-
ing. Trends Microbiol 9, 5–8.
45 Laemmli UK (1970) Cleavage of structural proteins
during the assembly of the head of bacteriophage T4.
Nature 227, 680–685.
46 Carvalho CM, Wellink J, Ribeiro SG, Goldbach RW &
Van Lent JW (2003) The C-terminal region of the
movement protein of Cowpea mosaic virus is involved
in binding to the large but not to the small coat protein.
J Gen Virol 84, 2271–2277.
47 Goodfellow I, Chaudhry Y, Gioldasi I,
Gerondopoulos A, Natoni A, Labrie L, Laliberte JF &
Roberts L (2005) Calicivirus translation initiation
requires an interaction between VPg and eIF4E. EMBO
Rep 6, 968–972.
48 Kaiser WJ, Chaudhry Y, Sosnovtsev SV &
Goodfellow IG (2006) Analysis of protein–protein
interactions in the feline calicivirus replication complex.
J Gen Virol 87, 363–368.
49 Leonard S, Plante D, Wittmann S, Daigneault N,
Fortin MG & Laliberte JF (2000) Complex formation