Structural features in the C-terminal region of the
Sinorhizobium meliloti RmInt1 group II intron-encoded
protein contribute to its maturase and intron
DNA-insertion function
Marı
´
a D. Molina-Sa
´
nchez, Francisco Martı
´
nez-Abarca and Nicola
´
s Toro
Grupo de Ecologı
´
a Gene
´
tica, Estacio
´
n Experimental del Zaidı
´
n, Consejo Superior de Investigaciones Cientı
´
ficas, Granada, Spain
Introduction
Group II introns are large catalytic RNAs found in
organelle and bacterial genomes that splice via a lariat
intermediate, in a mechanism similar to that of splice-
osomal introns [1]. The intron RNA folds into a con-
served 3D structure consisting of six distinct domains,
DI to DVI [2]. Unlike organellar introns, most bacte-

(domain X) associated with RNA splicing or maturase activity and a
C-terminal DNA binding ⁄ DNA endonuclease region. The intron-encoded
protein encoded by the mobile group II intron RmInt1, which lacks the
DNA binding ⁄ DNA endonuclease region, has only a short C-terminal
extension (C-tail) after a typical domain X, apparently unrelated to the
C-terminal regions of other group II intron-encoded proteins. Multiple
sequence alignments identified features of the C-terminal portion of the
RmInt1 intron-encoded protein that are conserved throughout evolution in
the bacterial ORF class D, suggesting a group-specific functionally impor-
tant protein region. The functional importance of these features was dem-
onstrated by analyses of deletions and mutations affecting conserved amino
acid residues. We found that the C-tail of the RmInt1 intron-encoded
protein contributes to the maturase function of this reverse transcriptase
protein. Furthermore, within the C-terminal region, we identified, in a
predicted a-helical region and downstream, conserved residues that are
specifically required for the insertion of the intron into DNA targets in the
orientation that would make it possible to use the nascent leading strand
as a primer. These findings suggest that these group II intron intron-
encoded proteins may have adapted to function in mobility by different
mechanisms to make use of either leading or lagging-oriented targets in the
absence of an endonuclease domain.
Abbreviations
D, DNA binding; En, DNA endonuclease; IEP, intron-encoded protein; RT, reverse transcriptase.
244 FEBS Journal 277 (2010) 244–254 ª 2009 The Authors Journal compilation ª 2009 FEBS
in vivo [3–6]. Mobility of these group II introns occurs
by means of a target DNA-primed reverse transcrip-
tion mechanism involving a RNP complex containing
both the intron RNA and the IEP [7–9].
The group II IEPs have an N-terminal RT domain
homologous to retroviral RTs, followed by a putative

tein (approximately 10% of wild-type).
Three main classes (IIA, IIB and IIC) of group II
introns have been described based on the conserved
intron RNA structures [2,20–25]. The L. lactis Ll.ltrB
intron and the yeast aI1 and aI2 introns, which are the
best studied mobile introns and serve as a paradigm
for group II intron mobility, all belong to the IIA
class. The Sinorhizobium meliloti group II intron
RmInt1 is a mobile intron that belongs to subclass
IIB3 [24], showing a IIB-like RNA structure with some
IIA features [21]. Phylogenetic analysis of RT and X
domains has resulted in classification of the ORFs into
several groups [A, B, C, D, E, F, CL1 (chloroplast-like
1), CL2 (chloroplast-like 2) and ML (mitochondria-
like)] [21,22,26]. The RmInt1 IEP belongs to bacterial
ORF class D [21,22]. Moreover, unlike lactococcal and
yeast introns, the RmInt1 IEP and the members of
this class lack the C-terminal D ⁄ En region
[11,14,21,24,27,28]. In vitro assays have shown that
RmInt1 RNPs are thus unable to carry out second-
strand cleavage but do perform reverse splicing into
the target site, in both single- and double-stranded
DNA substrates [29]. RmInt1 is an efficient mobile
element with two retrohoming pathways for mobility;
the preferred pathway involves reverse splicing of the
intron RNA into single-stranded DNA at a replication
fork, using the nascent lagging DNA strand as the pri-
mer for reverse transcription [30]. Similar to the lacto-
coccal and yeast introns, RmInt1 retrohoming also
requires base-pairing interactions between the intron

C-terminal region (domain X and downstream resi-
dues) of class D proteins (see Materials and methods).
The C-terminal region includes the two most highly
conserved sequence motifs in domain X of group II
IEPs: RGWXNYY (RmInt1 residues 349–355) and
R(K ⁄ R)XK (RmInt1 residues 380–383). The predicted
secondary structure of the RmInt1 domain X includes
M. D. Molina-Sa
´
nchez et al. Group II intron maturase C-terminal region
FEBS Journal 277 (2010) 244–254 ª 2009 The Authors Journal compilation ª 2009 FEBS 245
four putative a-helices, as in most group II IEPs [13],
and a putative short b-strand in the C-tail. The two
conserved domain X motifs are found at or near the
C-termini of a2 and a3, respectively. The a-helices a1,
a2 and a3 potentially correspond to a-helices aH, aI
and aJ in the thumb of HIV-RT [13].
The domain X region of group II intron RTs
extends downstream from aJ into the region corre-
sponding to the connection domain of HIV-1 RT
[10], which is characterized by three adjoining
b-strands involved in protein dimerization [13]. This
downstream region contains a conserved lysine resi-
due in domain X (K483 in LtrA) [13], whose muta-
tion reduces maturase activity [12]. Interestingly, the
amino acid residue in the equivalent position of
ORF class D is a highly conserved leucine residue
(L396 in RmInt1) located at the C-terminus of
a-helix a4. Upstream of this conserved leucine resi-
due at the N-terminus of a-helix a4, the domain X

(Fig. 2A). Intron RNA excision was analyzed by pri-
mer extension in both total RNA (Fig. 2B) and RNP
particles preparations (Fig. 2C) using a primer P (see
Materials and methods) complementary to a sequence
located 80–97 nucleotides from the 5¢ end of the intron
[29]. The previously reported domain X mutant
K381A [33], in which the last conserved lysine residue
of the conserved R(K ⁄ R)XK motif was replaced by
an alanine residue, retained RNA splicing activity
(approximately 30% of wild-type), measured in both
RNA and RNP particle preparations. These data
suggest that the mutant K381A remains capable of
binding the spliced lariat intron RNA. By contrast, the
Fig. 1. Multiple sequence alignments. The C-terminal region of the RmInt1 IEP (Sr.me.I1) was aligned with other group II IEPs of class D,
using
CLUSTALW. Conserved amino acid residues are highlighted: black, > 50% identity; gray, > 50% similarity; shading was achieved with
BOXSHADE ( Residue numbers are according to the RmInt1 sequence. The predicted
secondary structure of the RmInt1 IEP domain X, based on the
JPRED folding prediction, is shown above the alignments, and a consensus
sequence (indicated by dots) is shown below. Residues identical in all sequences are indicated by asterisks. Highly conserved motifs in the
X domain of group II IEPs RGWXNYY (RmInt1 residues 349–355) and R(K ⁄ R)XK (RmInt1 residues 380–383) are indicated by a line above the
secondary structure prediction. The putative boundaries of domain X and the C-tail [11] are indicated by opposing arrows separated by a
dashed line and a question mark. The bacterial species and the corresponding accession numbers of the IEPs are: S. meliloti (Sr.me.I1,
NP_437164); Ensifer adhaerens (E.a.I1, AAP83798); Sinorhizobium medicae (Sr.med., YP 001313619); Sinorhizobium terangae (Sr.t.I1,
AAU95643); E. coli (E.c.I2, CAA54637); Shewanella putrefaciens (Sh.p., YP_001181807); Azoarcus sp. EbN1 (Az.sp., YP_159836); Legionel-
la pneumophila (L.p., YP_001251128); E. coli B (E.c., ZP_01698243); Prosthecochloris aestuarii (Pr.ae.I3, ZP_00592895); Prosthecochloris
vibrioformis (Pr.vi.I1, YP_001129678); Pelodyction phaeoclathratiforme (Pe.ph.I1, ZP_00589124); Chlorobium phaeobacteroides (Ch.ph.,
YP_911931); Syntrophus aciditrophicus (Sy.a., YP_460783); Methanosarcina acetivorans (M.a.I5, NP_619481); uncultured archaeon
Gzfos32G12 (UA.I3,, AAU83697); Bacillus thuringiensis (B.thu., ZP_00738538); Paracoccus denitrificans (Pa.de.I1, ZP_00628808); Photorhab-
dus luminescens (Ph.l.I2, NP_928428); Magnetococcus sp. (Ma.sp.I3, YP_864580); Pseudomonas aeruginosa (P.ae., ABR13526); Pseudomo-

Therefore, the pattern of inhibition for the C-terminal
truncations was consistent with proteins that are
missfolded, unstable and ⁄ or unable to interact with
their substrates. Thus, we conclude that the C-tail is
structurally and functionally important for these RT
proteins.
Despite the conserved amino acid residues H388,
K389, R391 and A392 in the predicted a-helix a4 and
the neighboring A400 and P404 in the D motif being
substituted by amino acid residues with very different
structures and properties (Fig. 2A), point mutants
retained substantial RNA splicing activity (‡ 70% of
wild-type) in both RNA (Fig. 2B) and RNP extracts
(Fig. 2C). These results suggest that the former amino
acid residues are not required for the maturase func-
tion of this IEP. By contrast, the mutants in the con-
served residues L396, L406, F407 and W410 within the
D motif showed a greater reduction in the splicing
activity that decreased to 18–60% of wild-type, which
suggests that these amino acid residues contribute to
intron RNA splicing. Furthermore, the mutation of
the conserved amino acid residue H409 (H409G),
which is invariant in multiple sequence alignments,
abolished RNA splicing. Taken together, these findings
show that the C-tail contributes to the maturase func-
tion of these RT proteins and reveal that H409 is the
most critical amino acid residue.
Effect of mutations in the C-terminal region of
the RmInt1 IEP on intron mobility
To test the retrohoming ability of the RmInt1 C-termi-

when cloned in the orientation that would make it possi-
ble to use the nascent lagging DNA strand as a primer
for reverse transcription (pJB0.6LAG), the preferred
retrohoming pathway of RmInt1. Therefore, for these
mutants that retain a substantial level of splicing activity
(‡ 50% of wild-type), intron mobility cannot be directly
predicted from the extent of splicing. Thus, these con-
served residues appear to contribute to intron mobility
and are specifically required for the insertion of the
intron into DNA targets in the orientation that would
make it possible to use the nascent leading strand as a
primer for reverse transcription. Additional data further
support the above conclusion: the W410F mutant
showed a similar reduction of retrohoming (47% of
wild-type) in a target in the lagging strand orientation
but still had retrohoming in the leading strand template
(55% of wild-type). Furthermore, similar mutations in
more efficient constructs (DORF and IEP expressed in
cis; not shown) showed a similar bias for intron mobility
(Fig. S1). It has been suggested that this minor retroh-
oming pathway [30] may involve reverse splicing into
either double-stranded DNA or transiently single-
stranded DNA target sites, and that priming may
include random nonspecific opposite-strand nicks, a
nascent leading strand or de novo initiation of cDNA
synthesis. Because most of these mutants were able to
cleave single- and double-stranded DNA substrates
(Fig. 4), the impairment of mobility may reflect the
requirement of these residues for specific interactions
that are required to initiate the priming reaction after

Bacterial strains, media and growth conditions
S. meliloti RMO17 was cultured at 28 °C on TY medium
for RNA extraction and RNP particle isolation. Escherichia
coli DH5a was used for the construction of mutants and
cloning. E. coli was grown in LB medium at 37 °C. For
plasmid maintenance, the antibiotic kanamycin was
added at a concentration of 200 lgÆmL
)1
for rhizobia
and 50 lgÆmL
)1
for E. coli; ampicillin was added at a
concentration of 200 lgÆmL
)1
for both; and the medium
was supplemented with tetracycline at a concentration of
10 lgÆmL
)1
for mobility assays.
Sequence alignments and secondary-structure
prediction
We searched the NCBI database for class D group II IEPs,
using blastp with the amino-acid sequence (127 residues) of
Fig. 3. Retrohoming in vivo of wild-type RmInt1 and mutant derivatives on DNA target sites cloned in opposite orientations relative to the
direction of plasmid replication. Plasmid pools from S. meliloti RMO17 harboring donor (pKG2.5) and target plasmids (pJB0.6LEAD or
pJB0.6LAG) were analyzed by digestion and Southern hybridization with an exon-specific probe. Recipient plasmid without the DNA target
(pJBD129) was used as a negative control in the assays. Schematic diagrams of the mobility assays are shown at the top (not drawn to
scale). The SalI restriction sites (S) in the plasmids as well as the orientation of the target with respect to the replication fork (arrows) are
indicated. The recipient plasmids contain the intron DNA target cloned in the same (LAG) or in opposite (LEAD) orientation depending on
whether the nascent lagging or leading DNA strand could be used as a primer for reverse transcription of the inserted intron RNA. The

1asaSphI fragment [29]. The changes were introduced
through the use of DNA oligonucleotides, hybridizing
around the position of the intended mutation and abolish-
ing antibiotic resistance. The final constructs were generated
by inserting the RmInt1-containing fragment resulting from
BamHI ⁄ SpeI digestion of pAL2.5 into pKG0. The primers
used for mutagenesis are shown in Table S1. The pKG2.5-
V400 mutant was constructed by a two-step PCR procedure
using the Triple MasterÔ PCR System (Eppendorf, Ham-
burg, Germany). Two pairs of primers were designed to
amplify the 5¢ and 3¢ sections of the IEP, respectively: a 5¢
end primer mut UP (5¢-GTCAGCGGTGCTGGAAG
TATG-3¢) and a 3¢ end primer A400V ⁄ DN (5¢ -ATTTT
CCCGCACCAGCTTTCGCAAGA-3¢) were used to gener-
ate the upstream 824 bp fragment; a 5¢ end primer
A400V ⁄ UP (5¢-GAAAGCTGGTGCGGGAAAATCCGG
G-3¢) and a 3¢ end primer mut DN (5¢-GCGCGCGTAAT
ACGACTCAC-3¢) were used to generate the downstream
689 bp fragment. The mutagenic primers contained a 20 bp
region of overlap and introduced a valine (V) residue in
place of the moderately conserved alanine (A) in position
400 of the IEP, by changing C>T in intron position 1745.
The final 1492 bp fragment was amplified, digested with
EcoRI and SpeI and used to replace the corresponding
wild-type fragment in pKG2.5.
RNA isolation and RNP particle preparation
RNA and RNPs were extracted from free-living cultures of
S. meliloti strain RMO17 containing plasmids encoding the
wild-type or mutant RmInt1, as described previously
Fig. 4. Effect of mutations in the C-terminal region of the RmInt1 IEP on DNA cleavage. The panel on the left shows cleavage in a 5¢-labeled,

were carried out essentially as previously described [29].
The annealing mixture had a volume of 10 lL and con-
tained either 15 lg of total RNA or 0.125 A
260
units
(equivalent of 5 lg of single-stranded RNA) of RNP par-
ticles and 0.2 pmol (300 000 c.p.m.) of [5¢-
32
P]-labeled
P primer (5¢-TGA AAG CCG ATC CCG GAG-3¢)in
10 mm Pipes (pH 7.5) and 400 mm NaCl. This mixture
was first heated at 85 °C for 5 min, and was then rapidly
cooled to 60 °C and allowed to cool more slowly to
45 °C. Extension reactions were initiated by adding 40 lL
of 50 mm Tris–HCl (pH 8.0), 60 mm NaCl, 10 mm dith-
iothreitol, 6 mm MgOAc, 1 mm each of all four dNTPs,
60 lgÆmL
)1
of actinomycin D (Sigma, St Louis, MO,
USA), 15 units of RNAguardÔ RNase inhibitor (GE
Healthcare, Milwaukee, WI, USA) and 7 units of AMV
RT (Roche Diagnostics, Basel, Switzerland). Reaction
mixtures were incubated at 42 °C for 60 min. The reaction
was stopped by adding 15 lLof3m NaAc (pH 5.2) and
150 lL of cold ethanol. Samples were resolved by electro-
phoresis in a denaturing 6% polyacrylamide gel. Primer
extension products were quantified with Quantity One
software package (Bio-Rad Laboratories, Hercules, CA,
USA) and excision efficiency was measured as
100[S ⁄ (S + Pr)].

strand) to check top-strand cleavage. Single-stranded DNA
substrate (ssDNA70) was obtained by labeling 100 pmol of
HPLC-purified primer WT (5¢-AATTGATCCCGCCCG
CCTCGTTTTCATCGATGAGACCTGGACGAAGACGA
ACATGGCGCCGCTGCGGGGC-3¢) using 50 lCi of
[c-
32
P]ATP (3000 CiÆ mmol
)1
; GE Healthcare) and 100 units
of T4 polynucleotide kinase (New England Biolabs Inc.,
Ipswich, MA, USA). The double-stranded DNA substrates
(dsDNA70) used in top-strand cleavage and reverse splicing
assays were obtained in the same way. The oligonucleotide
WT was used as a template for amplification of a 70 bp
PCR product with [5¢-
32
P]-labeled S70ds ⁄ UP (5¢-AATT-
GATCCCGCCCGCCTC-3¢) and S70ds ⁄ DN (5¢-GCCCCG
CAGCGGCGCCATGTT-3¢) primers. For PCR, we added
2.5 · 10
)3
pmol of primer template, 50 pmol of each oligo-
mer, 20 pmol of dNTP equimolar mix and 0.2 units of Vent
polymerase (New England Biolabs). The amplification con-
ditions were: 94 °C for 2 min, followed by 25 cycles of
94 °C for 30 s and 60 °C for 30 s, with a final extension at
72 °C for 5 min. Both substrates were gel-purified, eluted
overnight in TE and 0.5 mm ammonium acetate and precip-
itated in ethanol. For the assays, the

Tecnologı
´
a and grant CVI-01522 from Junta de
Andalucı
´
a. M.D.M S. was supported by a predoctoral
fellowship from Junta de Andalucı
´
a.
References
1 Michel F & Ferat JL (1995) Structure and activities of
group II introns. Annu Rev Biochem 64, 435–461.
2 Michel F, Umesono K & Ozeki H (1989) Comparative
and functional anatomy of group II catalytic introns –
a review. Gene 82, 5–30.
3 Carignani G, Groudinsky O, Frezza D, Schiavon E,
Bergantino E & Slonimski PP (1983) An mRNA matur-
ase is encoded by the first intron of the mitochondrial
gene for the subunit I of cytochrome oxidase in S. cere-
visiae. Cell 35, 733–742.
4 Moran JV, Mecklenburg KL, Sass P, Belcher SM,
Mahnke D, Lewin A & Perlman PS (1994) Splicing
defective mutants of the COXI gene of yeast mitochon-
drial DNA: initial definition of the maturase domain
of the group II intron aI2. Nucleic Acids Res 22,
2057–2064.
5 Saldanha R, Chen B, Wank H, Matsuura M, Edwards
J & Lambowitz AM (1999) RNA and protein
catalysis in group II intron splicing and mobility
reactions using purified components. Biochemistry 38,

J Mol Biol 340, 211–231.
13 Blocker FJH, Mohr G, Conlan LH, Qi L, Belfort M &
Lambowitz A (2005) Domain structure and three-
dimensional model of a group II intron-encoded reverse
transcriptase. RNA 11, 14–28.
14 Gorbalenya AE (1994) Self-splicing group I and group
II introns encode homologous (putative) DNA endo-
nucleases of a new family. Protein Sci 3, 1117–1120.
15 Shub DA, Goodrich-Blair H & Eddy SR (1994) Amino
acid sequence motif of group I intron endonucleases is
conserved in open reading frames of group II introns.
Trends Biochem Sci 19, 402–404.
16 Zimmerly S, Guo H, Eskes R, Yang J, Perlman PS &
Lambowitz AM (1995) A group II intron RNA is a cat-
alytic component of a DNA endonuclease involved in
intron mobility. Cell 83, 529–538.
17 Guo H, Zimmerly S, Perlman PS & Lambowitz AM
(1997) Group II intron endonucleases use both RNA
and protein subunits for recognition of specific
sequences in double-stranded DNA. EMBO J 16,
6835–6848.
18 Matsuura M, Saldanha R, Ma H, Wank H, Yang J,
Mohr G, Cavanagh S, Dunny GM, Belfort M &
Lambowitz AM (1997) A bacterial group II intron
encoding reverse transcriptase, maturase, and DNA
endonuclease activities: biochemical demonstration of
maturase activity and insertion of new genetic informa-
tion within the intron. Genes Dev 11, 2910–2924.
19 Singh NN & Lambowitz AM (2001) Interaction of a
group II intron ribonucleoprotein endonuclease with

25 Toro N, Jime
´
nez-Zurdo JI & Garcı
´
a-Rodrı
´
guez FM
(2007) Bacterial group II introns: not just splicing.
FEMS Microbiol Rev 31 , 342–358.
26 Simon DM, Claske NA, McNeil BA, Johnson I, Pan-
tuso D, Dai L, Chai D & Zimmerly S (2008) Group II
introns in Eubacteria and Archaea: ORF-less introns
and new varieties. RNA 14, 1704–1713.
27 Martı
´
nez-Abarca F, Garcı
´
a-Rodrı
´
guez FM & Toro N
(2000) Homing of a bacterial group II intron with
an intron-encoded protein lacking a recognizable
endonuclease domain. Mol Microbiol 35, 1405–
1412.
28 Dai L & Zimmerly S (2002) Compilation and analysis
of group II intron insertions in bacterial genomes:
evidence for retroelement behavior. Nucleic Acids Res
30, 1091–1102.
29 Mun
˜

a-Rodrı
´
guez FM, Barrientos-
Dura
´
n A & Toro N (2003) DNA target site require-
ments for homing in vivo of a bacterial group II intron
encoding a protein lacking the DNA endonuclease
domain. J Mol Biol 326, 413–423.
32 Costa M, Michel F & Toro N (2006) Potential for
alternative intron-exon pairings in group II intron
RmInt1 from Sinorhizobium meliloti and its relatives.
RNA 12, 338–341.
33 Molina-Sa
´
nchez MD, Martı
´
nez-Abarca F & Toro N
(2006) Excision of the Sinorhizobium meliloti group II
intron RmInt1 as circles in vivo.
J Biol Chem 281,
28737–28744.
34 Crooks GE, Hon G, Chandonia JM & Brenner SE
(2004) WebLogo: a sequence logo generator. Genome
Res 14, 1188–1190.
35 Schneider TD & Stephens RM (1990) Sequence logos: a
new way to display consensus sequences. Nucleic Acids
Res 18, 6097–6100.
Supplementary information
The following supporting information is available: