Tài liệu Báo cáo khoa học: Proton transfer in the oxidative half-reaction of pentaerythritol tetranitrate reductase Structure of the reduced enzyme-progesterone complex and the roles of residues Tyr186, His181 and His184 - Pdf 10

Proton transfer in the oxidative half-reaction of
pentaerythritol tetranitrate reductase
Structure of the reduced enzyme-progesterone complex and the
roles of residues Tyr186, His181 and His184
Huma Khan
1
, Terez Barna
1
, Neil C. Bruce
2
, Andrew W. Munro
1,
*, David Leys
1,
† and
Nigel S. Scrutton
1,

1 Department of Biochemistry, University of Leicester, UK
2 CNAP, Department of Biology, University of York, UK
Pentaerythritol tetranitrate (PETN) reductase was ori-
ginally purified from a strain of Enterobacter cloacae
(strain PB2) on the basis of its ability to utilize nitrate
ester explosives such as PETN and glycerol trinitrate
(GTN) as sole nitrogen source. Sequence analysis [1]
and structural studies [2] have indicated that PETN
reductase is a flavoprotein member of the Old Yellow
Enzyme (OYE) family [3]. Other well-defined members
include bacterial morphinone reductase (MR) from
Pseudomonas putida M10 [4], estrogen binding protein
Keywords

H184A enzymes retain activity in reductive and oxidative half-reactions,
and thus do not play an essential role in catalysis. Ligand binding and
catalysis is not substantially impaired in Y186F PETN reductase, which
contrasts with data for the equivalent mutation (Y196F) in Old Yellow
Enzyme. The structure of Y186F PETN reductase is identical to wild-type
enzyme, with the obvious exception of the mutation. We show in PETN
reductase that Tyr186 is not a key proton donor in the reduction of a ⁄ b
unsaturated carbonyl compounds. The structure of two electron-reduced
PETN reductase bound to the inhibitor progesterone mimics the catalytic
enzyme-steroid substrate complex and is similar to the structure of the
oxidized enzyme-inhibitor complex. The reactive C1-C2 unsaturated bond
of the steroid is inappropriately orientated with the flavin N5 atom for
hydride transfer. With steroid substrates, the productive conformation is
achieved by orientating the steroid through flipping by 180°, consistent
with known geometries for hydride transfer in flavoenzymes. Our data
highlight mechanistic differences between Old Yellow Enzyme and PETN
reductase and indicate that catalysis requires a metastable enzyme-steroid
complex and not the most stable complex observed in crystallographic
studies.
Abbreviations
EBP, estrogen binding protein; GTN, glycerol trinitrate; MR, morphinone reductase; OYE1, Old Yellow Enzyme 1; PETN, pentaerythritol
tetranitrate; TNT, trinitrotoluene.
4660 FEBS Journal 272 (2005) 4660–4671 ª 2005 FEBS
(EBP) from Candida albicans [5], glycerol trinitrate
reductase from Agrobacterium radiobacter [6], the
xenobiotic reductases of Pseudomonas species [7] and
12-oxophytodienoic acid reductase from tomato [8]
and Arabidopsis thaliana [9]. These enzymes reduce a
variety of cyclic enones, including 2-cyclohexen-1-one
and steroids. Some steroids act as substrates, whereas

served in PETN reductase as Tyr186 [1], and X-ray
structural and NMR analyses of PETN reductase in
complex with a number of steroid ligands have sugges-
ted this residue may likewise function as the key pro-
ton donor during the reduction of a ⁄ b unsaturated
carbonyl compounds by PETN reductase [2]. This act-
ive site tyrosine is not conserved in MR, where it is
replaced by cysteine [23,24]. Recent mutagenesis stud-
ies have failed to identify the key proton donor in
MR, and suggest solvent water is the source of the
proton required for reduction of a ⁄ b unsaturated car-
bonyl compounds [21,24,25]. Herein, we report solu-
tion studies of three mutant forms of PETN reductase.
We show that Tyr186 is not the key proton donor in
the oxidative half-reaction of PETN reductase, which
contrasts with reported studies with the highly homo-
logous OYE. We demonstrate that residues His181
and His184 are determinants for substrate ⁄ ligand bind-
ing as suggested by the crystal structure of PETN
reductase, consistent with a similar role for conserved
residues in OYE [26] and MR [25]. We also report the
crystal structure of 2-electron reduced PETN reductase
in complex with the steroid inhibitor and discuss its
implications for the binding and reduction of steroid
substrates. Our studies demonstrate a probable role for
water in proton donation in PETN reductase and mul-
tiple binding modes for steroid ligands in the active
site. The work emphasizes the need for (i) detailed
evaluation of mechanism, and (ii) caution in inferring
mechanistic similarities in structurally highly related

two mutant enzymes H181A and H184A.
Both the H181A and H184A enzymes were purified
to homogeneity as described and, as for wild-type
enzyme [19], UV-visible spectra indicated stoichiometric
assembly with the FMN cofactor. Ligand binding titra-
tions revealed a substantially increased dissociation
H. Khan et al. Proton transfer in PETN reductase
FEBS Journal 272 (2005) 4660–4671 ª 2005 FEBS 4661
constant for enzyme-ligand complexes, consistent with
a key role for both residues in the binding of substrates
and inhibitors (Table 1; Fig. 2). Anaerobic stopped-
flow studies of FMN reduction by NADPH in H181A
and H184 enzymes indicated reduction of the FMN,
but unlike for wild-type enzyme [19] there was no evi-
dence at % 560 nm for an oxidized enzyme-NADPH
charge-transfer intermediate prior to FMN reduction
(Fig. 3A). Plots of observed rate constant vs. NADPH
concentration were hyperbolic for the mutant enzymes,
and limiting rate constants for FMN reduction were
elevated modestly compared with wild-type PETN
reductase (Fig. 3A, inset; Table 2). The exchange of
His181 and His184 residues by alanine, however, com-
promised binding of reducing coenzyme in the active
site (Table 2). Stopped-flow studies in which 2-electron
reduced enzyme (obtained by titration against dithio-
nite) was mixed with 2-cyclohexen-1-one indicated that
both the H181A and H184A enzymes are able to trans-
fer electrons to 2-cyclohexen-1-one (Fig. 3B). In both
cases, single wavelength stopped-flow studies at 450 nm
established that observed rate constants for FMN oxi-

Arabidopsis thaliana), BAIH (bile acid-indu-
cible protein from Eubacterium species),
NADH (NADH oxidase from Thermobacillus
brockii). The arrows indicate the positions of
histidine residues in PETN reductase
inferred to be involved in ligand binding and
counterpart residues in related enzymes and
also the location of the tyrosine residue
implicated as proton donor in OYE.
Table 1. Dissociation constants for enzyme-ligand complexes calcu-
lated from equilibrium titrations. Enzymes (each 10 l
M) were titra-
ted with picric acid, progesterone and 2,4-dinitrophenol in 50 m
M
potassium phosphate buffer, pH 7.0, in a 1 mL quartz cuvette.
Spectra were recorded after the addition of ligand to the enzyme.
From the resultant spectra (examples shown in Fig. 2) the absorp-
tion changes at 518 nm were plotted as a function of ligand con-
centration and fitted to a hyperbolic or quadratic function from
which the dissociation constants were determined. Dissociation
constants for wild-type enzyme-ligand complexes are taken from
[2,19].
Dissociation constant (K
d
, lM)
Picric
acid 2,4-Dinitrophenol Progesterone
Wild-type PETN reductase 5.4 ± 1.1 0.95 ± 0.10 0.07 ± 0.03
H181A PETN reductase 92 ± 12 56 ± 7 16 ± 5
H184A PETN reductase 73 ± 16 34 ± 6 15 ± 3

flavin oxidation rate on TNT concentration (Fig. 3D);
limiting rate constants and reduced enzyme-TNT disso-
ciation constants are presented in Table 2. The reduc-
tion potentials of the FMN centres in the H184A and
H181A enzymes were determined to be )266 ± 5 mV
and )229 ± 5 mV, respectively, which compares with
a value of )267 mV for wild-type enzyme [20].
Fig. 2. Analysis of ligand binding by equilibrium titration studies. (A) UV-visible analysis of the titration of H181A PETN reductase with 2,4
dinitrophenol. Inset, detail of the absorbance change around 518 nm used to calculate the dissociation constant for the complex. (B) UV-visi-
ble analysis of the titration of H181A PETN reductase with progesterone. (C) Plot of absorbance change as a function of 2,4 dinitrophenol
concentration for the data shown in (A). (D) Plot of absorbance change as a function of progesterone concentration for the data shown in
(B). Conditions for panels A and B: 50 m
M potassium phosphate buffer pH 7.0, 25 °C. Similar plots were generated for other enzyme-ligand
combinations. Dissociation constants for the enzyme–ligand complexes are given in Table 1. Arrows indicate direction of absorption change
with time.
H. Khan et al. Proton transfer in PETN reductase
FEBS Journal 272 (2005) 4660–4671 ª 2005 FEBS 4663
Properties of the Y186F PETN reductase
Equilibrium binding measurements with picric acid,
2,4-dinitrophenol and progesterone were performed as
described for wild-type and the H181A and H184A
enzymes. Spectral changes were similar to those repor-
ted above and absorption changes at 518 nm were
used to determine enzyme-ligand dissociation constants
(Table 1). Enzyme-ligand dissociation constants for
nitroaromatic ligands are elevated approximately two-
fold compared with wild-type enzyme, whereas the
binding of progesterone is essentially unaffected by
mutation (Table 1).
Stopped-flow studies of flavin reduction by NADPH

1.0
51.0
2.
AB
CD
0
[
β
NAD
PH
] )Mm(
032154
k
obs
(s
-1
)
0
01
0
2
0
3
0
4
0
5
[
-
2

3.0
4.0
5.0
[NT T
]
(
µ
)M
000
2
00
4
00
6
0
08
0
00
1
kobs
(s
-1
)
0
5
01
5
1
0
2

.0
Fig. 3. Stopped-flow kinetic analysis of FMN reduction and oxidation in the H181A and H184A PETN reductases. (A) spectral changes
accompanying the reduction of H184A PETN reductase (20 l
M) by NADPH (200 lM). Four hundred spectra were recorded over a period of
one second. One in every 25 of the spectra is displayed. Conditions: 50 m
M potassium phosphate buffer, pH 7.0, at 5 °C. Inset: plot of
observed rate constant for FMN reduction as a function of NADPH concentration for H181A (filled squares) and H184A (filled circles). (B)
dependence of the observed rate for the oxidation of reduced FMN on 2-cyclohexen-1-one concentration for the H181A (filled squares) and
H184A (filled circles) PETN reductases. (C) Spectral changes accompanying the oxidation of 2-electron reduced H184A PETN reductase
(20 l
M) by TNT (200 lM). (D) dependence of the observed rate for the oxidation of reduced FMN on TNT concentration for the H181A ( )
and H184A (d) PETN reductases. Kinetic parameters are given in Table 2. Arrows indicate direction of absorption change with time.
Proton transfer in PETN reductase H. Khan et al.
4664 FEBS Journal 272 (2005) 4660–4671 ª 2005 FEBS
Stopped-flow studies of the oxidative half-reaction
of Y186F PETN reductase (reduced at the 2 electron
level with dithionite) with 2-cyclohexen-1-one revealed
a hyperbolic dependence of the rate of flavin oxidation
on 2-cyclohexen-1-one concentration (Fig. 4D). The
limiting rate constant for flavin oxidation is % twofold
less than that for wild-type enzyme (Table 2). Stopped-
flow studies of the oxidative half-reaction of Y186F
PETN reductase with TNT indicated formation and
subsequent decay of the hydride Meisenheimer com-
plex (Fig. 4B,C), indicating that residue Y186 does not
influence strongly the partitioning along the hydride
transfer and nitroreductase pathways. The rate of
Meisenheimer complex formation measured at 560 nm
was shown to be equivalent to that for FMN oxidation
at 464 nm, indicating that both processes are kinetic-

isoalloxazine ring is less planar, with both the N5
atom and the C8-C7 methyl groups moving to signi-
ficantly out-of-plane positions. The progesterone sub-
strate is bound in a similar manner, albeit shifted by
approximately 0.4 A
˚
towards the Thr26 side chain.
This places the progesterone C4—C5 double bond in
close proximity to the FMN N5 atom (distances 3.47
and 3.61 A
˚
for C4-N5 and C5-N5, respectively).
While this distance is ideal for reduction of the dou-
ble bond by FMN, the N10-N5-C5 angle value of
92° (Fig. 7B) is distinct form the range of angles
(125° to 170°) observed in flavoenzyme-substrate
complexes [31]. Any putative motion of the pro-
gesterone molecule required to increase the N10-N5-
C5 angle to within or close to the 125° to 170°
range causes severe steric clashes of the C6 carbon
atom with the Thr26 side chain, explaining why
progesterone is an inhibitor rather than a substrate
for this enzyme. The presence of Cb atom at posi-
tion 26 therefore causes the substrate specificity of
Table 2. Kinetic parameters for the reductive and oxidative half-reactions of wild-type, H181A, H184A and Y186F PETN reductases. Kinetic
data are shown in Figs 3 and 4. Parameters were determined by fitting to a standard hyperbolic expression to obtain values for the limiting
rate of flavin reduction or oxidation (k
lim
) and the enzyme-substrate dissociation constants (K
d

d
(lM)
Wild-type PETN reductase
a
35 ± 2 9.5 ± 1.6 4.5 ± 0.1 78.4 ± 11.7
H181A PETN reductase 0.34 ± 0.01 19.2 ± 1.5 9.3 ± 0.4 194 ± 27
H184A PETN reductase 0.49 ± 0.02 44 ± 4 15.8 ± 0.3 134 ± 11
Y186F PETN reductase 14 ± 1 2.1 ± 0.2 6.9 ± 0.3 164 ± 24
a
Data taken from [19].
H. Khan et al. Proton transfer in PETN reductase
FEBS Journal 272 (2005) 4660–4671 ª 2005 FEBS 4665
the enzyme to be limited to enones with a primary
or secondary b-carbon such as steroids with a double
bond located between C1 and C2. However, crystal
structures of the oxidized enzyme in complex with
C1-C2 unsaturated steroids reveal a mode of binding
similar to that observed for progesterone, placing the
C4-C5 bond rather than the reactive C1-C2 bond in
close proximity of the N5 atom. A putative flipping
motion of the progesterone molecule along an axis
parallel to the FMN plane aligns the C1-C2 with the
plane of the isoalloxazine ring and in close proximity
to the N5, with possibility of adopting a conforma-
tion with an appropriate N10-N5-C1 angle for cata-
lysis. Previous NMR data and modelling suggested
that the preferred orientation of steroid substrates
(with a C1-C2 double bond) might be different
dependent on the oxidation state of the protein [2].
Similar behaviour was also proposed recently for

0
15 0.
02
Absorbance
.0015
.
0
0
2
.00
2
5
.
0
0
3
.
0
035
.
0
0
4
Wavelength (nm)
030 400 050 600 070
Absorbance
0
.
01
.02

)
0
2
4
6
8
0
1
21
41
61
Fig. 4. (A) Typical stopped-flow transient obtained for the reductive half-reaction of Y186F PETN reductase at 464 nm. The absorption trace
was measured by mixing NADPH (200 l
M) with Y186F PETN reductase (20 lM)in50mM potassium phosphate buffer, pH 7.0, at 5 °C.
Inset: the small absorption change observed at 560 nm indicating formation of an oxidized enzyme-NADPH charge-transfer species over
0.02 s. Measurements over longer time periods indicate the absorption decreases with a rate constant similar to that observed at 464 nm,
which indicates reduction of the FMN. Conditions: 50 m
M potassium phosphate buffer, pH 7.0, at 5 °C. (B) Time-dependent spectral chan-
ges following the reaction of dithionite-reduced Y186F PETN reductase and TNT, using stopped-flow spectroscopy. Dithionite-reduced
Y186F PETN reductase (40 l
M) was mixed with (400 lM) TNT at 25 °C, in 1% acetone, potassium phosphate buffer, pH 7.0, under anaer-
obic conditions. Spectral changes are shown over 2 s, and indicate re-oxidation of the flavin and the formation of the hydride-Meisenheimer
complex of TNT. (C) As for panel B except the spectral changes are recorded over an extended time period and show degradation of the
hydride-Meisenheimer complex which generates the oxidized form of the enzyme. (D) The concentration-dependence of the rate of hydride
transfer from dithionite-reduced Y186F PETN reductase to 2-cyclohexen-1-one. Anaerobic single wavelength spectroscopy at 464 nm was
performed with 20 l
M enzyme and a range of 2-cyclohexen-1-one concentrations, in 50 mM potassium phosphate buffer, pH 7.0 at 25 °C.
The solid line shows the fit of the data to a hyperbolic function. Kinetic parameters are given in Table 2. Arrows indicate direction of absorp-
tion change with time.
Proton transfer in PETN reductase H. Khan et al.

for comparison and displayed in white sticks. The sigmaA weighted
F
0
-F
c
density for the progesterone molecule is displayed in blue. (B)
schematic displaying the steric clashes between enones with
tertiary Cb atoms and the Cb atom at position 26 for N10-N5-Cb
angles in the range of 125° to 170°.
R
A
C
B
O
O
O
O
O
O
O
1
2
3
4
5
6
7
8
9
01

1,
3

en
ee
n
o
i
d
-71
,
3-e
n
etsor
d
na-
4
eno
Fig. 6. Steroid nomenclature and chemical structures. (A) Nomen-
clature for atom labelling in 3-oxo steroids; (B) chemical structure
of the inhibitor progesterone; (C) reaction catalysed with the sub-
strate 1,4-androstadiene-3,17-dione.
Fig. 5. Superposition of the thiocyanide complex structures for
Y186F PETN reductase and wild-type PETN reductase. The struc-
ture of Y186F PETN reductase (shown in atom coloured sticks) is
similar to the wild-type enzyme (shown in white), confirming that
the mutation of Tyr186 to Phe186 does not grossly perturb the
overall framework of the enzyme or the active site. The active sites
of the enzymes are shown in stick format with the sigmaA weigh-
ted 2F

hexen-1-one and related substrates, and its mutation
leads to inactivation of the oxidative half-reaction [22].
Clearly, in PETN reductase proton transfer is not from
Tyr186 despite (i) the very similar structural architec-
ture of OYE1 and PETN reductase, and (ii) geometry
for the binding of steroid compounds and 2-cyclohe-
xen-1-one [2,19]. The structure of the Y186F enzyme is
essentially identical to that of wild-type PETN reduc-
tase, which therefore rules out major structural change
as a result of mutation that might have been respon-
sible for the recruitment of a surrogate proton donor
in the oxidative half-reaction. The overall structural
similarities of OYE1 and PETN reductase previously
led us to propose that Tyr186 (PETN reductase) might
function in a role analogous to that of Tyr196 (OYE1)
[2]. We now conclude, however, that as with MR
[25,36], proton transfer is most likely from water. This
therefore highlights subtle mechanistic differences
between family members despite their overall structural
similarity. No significant differences in position of
Y186 ⁄ 196 and nearby residues can be observed for
PETN reductase and available OYE structures (PDB
codes 1OYA, 1OYB). Detailed comparison of water
molecules in or near the active site is precluded due to
either lack of corresponding complexes with identical
molecules bound in the active site or sufficiently high
resolution data for the OYE complexes.
The structure of the 2-electron reduced form of
PETN reductase bound to progesterone is very similar
to that of the oxidized enzyme-progesterone complex.

substrate. It is probable that in both redox states the
majority of substrate-enzyme complexes adopt the
crystallographically determined structure and that
the catalytically active conformation is populated to
only a small extent and therefore represents a less sta-
ble form of the reduced enzyme-substrate complex. The
preferred binding mode that we observed in our crystal-
lographic studies is catalytically incompetent, and ster-
oid must either be released from the active site to allow
binding in the active configuration, or flipping of the
steroid must occur whilst resident in the active site. An
in situ flipping mechanism seems unlikely given the
extensive steric clashes and change in steroid conforma-
tion that must occur to allow rotation through 180°,
and we therefore favour a ‘release-and-rebinding’
mechanism. The low occupancy of the catalytically
competent form of the enzyme-substrate complex no
doubt contributes to the very low turnover numbers
for the PETN reductase-catalysed reduction of steroid
substrates [2].
Proton transfer in PETN reductase H. Khan et al.
4668 FEBS Journal 272 (2005) 4660–4671 ª 2005 FEBS
Experimental procedures
Chemicals
All chemicals were of analytical grade where possible. Com-
plex bacteriological media were from Unipath Ltd (Basing-
stoke, UK), and all media were prepared as described in
Sambrook et al. [27]. Mimetic Orange 2 affinity chromato-
graphy resin was from Affinity Chromatography Ltd (Cam-
bridge, UK). Q-Sepharose resin was from Amersham

Mutagenesis and purification of enzymes
Site-directed mutagenesis was achieved using the Quik-
change mutagenesis method (Stratagene, La Jolla, CA,
USA) and the following oligonucleotides: 5¢-TTCACTCTG
CGCACGGTTTTCTGCTGCATCAGTTC-3¢ (Y186F for-
ward primer), 5¢-GAACTGATGCAGCAGAAAACCGTG
CGCAGAGTGAA-3¢ (Y186F, reverse primer), 5¢-CTTCG
ACCTGGTTGAGCTTGCGTCTGCGCACGGTTACCTG-
3¢ (H181A forward primer), 5¢-CAGGTAACCGTGCGCG
ACGCAAGCTCAACCAGGTCGAAG-3¢ (H181A, reverse
primer), 5¢-GTTGAGCTTCACTCTGCGGCGGGTTACC
TGCTGCATCAG-3¢ (H184, forward primer) and 5¢-CTG
ATGCAGCAGGTAACCCGCCGCAGAGTGAAGCTCA
AC-3¢ (H184, reverse primer). Plasmid pONR1 [1] was used
as template for mutagenesis reactions. All mutant genes
were completely sequenced to ensure that spurious changes
had not arisen during the mutagenesis reaction. The expres-
sion and purification of the wild-type and mutant PETN
reductase enzymes was as described previously for wild-type
enzyme [1]. Owing to poor retention by the Mimetic
Orange 2 affinity chromatography resin used for purifica-
tion of wild-type PETN reductase, the H181A and H184A
enzymes were purified by Q-Sepharose ion exchange chro-
matography (pre-equilibrated with 50 mm Tris ⁄ HCl buffer,
pH 7.5; buffer A). The enzymes were subsequently eluted
using a salt gradient (0–200 mm NaCl contained in 500 mL
buffer A). Following an initial purification using Q-Seph-
arose resin a second chromatography step using the same
resin was required (gradient of 15–150 mm NaCl contained
in 1 L buffer A) to obtain pure protein.

Þ
2
Àð4L
T
E
T
Þ
ÀÁ
0:5
hi
ð1Þ
where DA
max
is the maximum absorption change at
518 nm, L
T
is the total ligand concentration and E
T
the
total enzyme concentration. Data for mutant enzymes were
calculated by fitting to the standard hyperbolic expression
(Eqn 2).
DA ¼
DA
max
L
T
K
d
þ L

Data collection
Completeness (%) 98.2 (84) 99.1 (98.4)
Redundancy 4.2 (3.1) 3.8 (3.5)
I ⁄ rI 11.1 (1.9) 12.2 (2.2)
R
sym
0.087 (0.489) 0.067 (0.438)
Resolution 15–1.0 (1.03–1.0) 15–1.05 (1.08–1.05)
Refinement
R
factor
0.127 (0.345) 0.117 (0.28)
R
free
0.147 (0.389) 0.143 (0.296)
RMSD bond lenghts (A
˚
) 0.017 0.016
RMSD bond angles (°) 0.003 0.003
H. Khan et al. Proton transfer in PETN reductase
FEBS Journal 272 (2005) 4660–4671 ª 2005 FEBS 4669
using an Applied Photophysics SF.17 mV stopped-flow
instrument contained within an anaerobic glove box as
described previously for wild-type PETN reductase [19].
Crystallography
Crystals were obtained as described for wild-type oxidized
enzyme [2]. Atomic resolution data were collected on ESRF
beamlines for the oxidized Y186F mutant and for dithio-
nite-reduced enzyme cocrystallised with progesterone. The
reduced progesterone complex crystals were grown and

resolution: overall structure, ligand binding, and compar-
ison with related flavoproteins. Structure 2, 1089–1105.
4 French CE & Bruce NC (1994) Purification and charac-
terization of morphinone reductase from Pseudomonas
putida M10. Biochem J 301, 97–103.
5 Madani ND, Malloy PJ, Rodriguez-Pombo P, Krishnan
AV & Feldman D (1994) Candida albicans estrogen-
binding protein gene encodes an oxidoreductase that is
inhibited by estradiol. Proc Natl Acad Sci USA 91,
922–926.
6 Snape JR, Walkley NA, Morby AP, Nicklin S & White
GF (1997) Purification, properties, and sequence of gly-
cerol trinitrate reductase from Agrobacterium radiobac-
ter. J Bacteriol 179, 7796–7802.
7 Blehert DS, Fox BG & Chambliss GH (1999) Cloning
and sequence analysis of two Pseudomonas flavoprotein
xenobiotic reductases. J Bacteriol 181, 6254–6263.
8 Strassner J, Furholz A, Macheroux P, Amrhein N &
Schaller A (1999) A homolog of Old Yellow Enzyme in
tomato. Spectral properties and substrate specificity of
the recombinant protein. J Biol Chem 274, 35067–35073.
9 Schaller F & Weiler EW (1997) Molecular cloning and
characterization of 12-oxophytodienoate reductase, an
enzyme of the octadecanoid signaling pathway from
Arabidopsis thaliana. Structural and functional relation-
ship to yeast Old Yellow Enzyme. J Biol Chem 272,
28066–28072.
10 Franklund CV, Baron SF & Hylemon PB (1993) Char-
acterization of the baiH gene encoding a bile acid-indu-
cible NADH: flavin oxidoreductase from Eubacterium

Moody PCE & Nicklin S (1999) The Old Yellow
Enzyme family of enzymes – comparison of substrate
specificity and activity against explosives. In Flavins and
Flavoproteins (Ghisla S, Kroneck P, Macheroux P &
Proton transfer in PETN reductase H. Khan et al.
4670 FEBS Journal 272 (2005) 4660–4671 ª 2005 FEBS
Sund H, eds), pp. 663–666. Rudolf Weber, Berlin,
Germany.
18 Williams R, Rathbone D, Moody P, Scrutton N &
Bruce N (2001) Degradation of explosives by nitrate
ester reductases. Biochem Soc Symp 68, 143–153.
19 Khan H, Harris RJ, Barna T, Craig DH, Bruce NC,
Munro AW, Moody PC & Scrutton NS (2002) Kinetic
and structural basis of reactivity of pentaerythritol tetra-
nitrate reductase with NADPH, 2-cyclohexenone,
nitroesters, and nitroaromatic explosives. J Biol Chem
277, 21906–21912.
20 Khan H, Barna T, Harris RJ, Bruce NC, Barsukov I,
Munro AW, Moody PC & Scrutton NS (2004) Atomic
resolution structures and solution behavior of enzyme-
substrate complexes of Enterobacter cloacae PB2
pentaerythritol tetranitrate reductase. Multiple confor-
mational states and implications for the mechanism of
nitroaromatic explosive degradation. J Biol Chem 279,
30563–30572.
21 Basran J, Harris RJ, Sutcliffe MJ & Scrutton NS (2003)
Hydrogen tunneling in the multiple H-transfers of the
catalytic cycle of morphinone reductase and in the
reductive half-reaction of the homologous pentaerythri-
tol tetranitrate reductase. J Biol Chem 278, 43973–

of macromolecular structures by the maximum-likeli-
hood method. Acta Crystallogr D53, 240–255.
31 Fraaije MW & Mattevi A (2000) Flavoenzymes: diverse
catalysts with recurrent features. Trends Biochem Sci 25 ,
126–132.
32 Race P, Lovering A, Green R, Ossor A, White S, Searle
P, Wrighton C & Hyde E (2005) Structural and
mechanistic studies of E. coli nitroreductase with the
antibiotic nitrofurazone: Reversed binding orientations
in different redox states of the enzyme. J Biol Chem
280, 13256–13264.
33 Malone TE, Madson SE, Wrobel RL, Jeon WB, Rosen-
berg NS, Johnson KA, Bingman CA, Smith DW, Phil-
lips GN Jr, Markley JL & Fox BG (2005) X-ray
structure of Arabidopsis At2g06050, 12-oxophytodieno-
ate reductase isoform 3. Proteins 58, 243–245.
34 Breithaupt C, Strassner J, Breitinger U, Huber R,
Macheroux P, Schaller A & Clausen T (2001) X-ray
structure of 12-oxophytodienoate reductase 1 provides
structural insight into substrate binding and specificity
within the family of OYE. Structure 9, 419–429.
35 Kitzing K, Fitzpatrick TB, Wilken C, Sawa J, Bourenkov
GP, Macheroux P & Clausen T (2005) The 1.3 A
˚
crystal
structure of the flavoprotein YqjM reveals a novel class
of Old Yellow Enzymes. J Biol Chem 280, 27904–27913.
36 Messiha H, Bruce N, Sattelle B, Sutcliffe M, Munro A
& Scrutton N (2005) Reaction of morphinone reductase
with 2-cyclohexen-1-one and 1-nitrocyclohexene: proton


Nhờ tải bản gốc

Tài liệu, ebook tham khảo khác

Music ♫

Copyright: Tài liệu đại học © DMCA.com Protection Status