How disorder influences order and vice versa – mutual
effects in fusion proteins containing an intrinsically
disordered and a globular protein
Ilaria Sambi
1
, Pietro Gatti-Lafranconi
1
*, Sonia Longhi
2
and Marina Lotti
1
1 Dipartimento di Biotecnologie e Bioscienze, Universita
`
di Milano-Bicocca, Italy
2 Architecture et Fonction des Macromole
´
cules Biologiques, Universite
´
Aix-Marseille I et II, France
Introduction
Until very recently, one of the pillars of protein science
has been the so-called structure–function paradigm,
which posits the formation of a unique 3D structure as
the prerequisite for biological function [1]. However,
during the last decade, numerous proteins have been
described that fail to adopt a stable tertiary structure
under physiological conditions and yet display biologi-
cal activity [2]. This condition, defined as intrinsic
disorder, has been found to be widespread in func-
tional proteins. Importantly, disordered regions are
often required for biological activity, indicating that

or partly lacking stable secondary and tertiary structure under physiologi-
cal conditions that are involved in important biological functions, such as
regulation and signalling in eukaryotes, prokaryotes and viruses. The func-
tion of many IDPs relies upon interactions with partner proteins, often
accompanied by conformational changes and disorder-to-order transitions
in the unstructured partner. To investigate how disordered and ordered
regions interact when fused to one to another within the same protein, we
covalently linked the green fluorescent protein to three different, well char-
acterized IDPs and analyzed the conformational properties of the fusion
proteins using various biochemical and biophysical approaches. We
observed that the overall structure, compactness and stability of the chime-
ric proteins all differ from what could have been anticipated from the
structural features of their isolated components and that they vary as a
function of the fused IDP.
Abbreviations
GFP, green fluorescent protein; IDP, intrinsically disordered protein.
4438 FEBS Journal 277 (2010) 4438–4451 ª 2010 The Authors Journal compilation ª 2010 FEBS
resource rather than a defect. According to this novel
perspective, the straightforward quest for structural
features engaged in a function is moving towards a
dynamic view in which function arises from conforma-
tional freedom. Fully or partly nonstructured proteins
are generally referred to as intrinsically disordered
(IDPs) or intrinsically unstructured proteins, or also as
natively unfolded proteins, a term that emphasizes the
fact that, to fulfil their tasks within the cell, these poly-
peptides rely on existing as a dynamic ensemble of dif-
ferent conformations [3–5]. The intrinsic flexibility of
IDPs indeed provides a clue with respect to their broad
biological functions and high occurrence among pro-

Although the isolated disordered domains of these lat-
ter proteins have been studied in depth, comprehensive
data on the full-length polypeptides are lacking, with
the data available so far only suggesting that unstruc-
tured regions maintain this feature in the context of
the entire proteins [19–21]. However, evidence that dis-
ordered regions may impact on linked globular
domains arises from work performed in a different
context. In particular, studies by Bae et al. [22] focused
on the prediction of rotational tumbling times of
proteins containing disordered segments, and high-
lighted the effects of the unordered regions on the
properties of covalently linked globular domains (in
this case on the tumbling of the rigid part), with the
extent of the perturbation being proportional to the
length of the disordered region.
With the aim of investigating the reciprocal confor-
mational effect of covalently linked structured and
unstructured protein regions, we fused green fluores-
cent protein (GFP) with disordered fragments of dif-
ferent origin and compactness and investigated the
properties of these fusion proteins using biochemical
and biophysical methods. GFP is a globular protein
with a stable fold and known 3D structure [23]. Its flu-
orophore provides a specific marker to monitor struc-
tural changes in GFP only. As disordered moieties, we
used the unstructured regions of two measles virus
proteins (NTAIL and PNT) and the whole Saccharo-
myces cerevisiae SIC1 protein. Although they are all
IDPs, these proteins have different structural features

I. Sambi et al. Ordered and disordered protein domains
FEBS Journal 277 (2010) 4438–4451 ª 2010 The Authors Journal compilation ª 2010 FEBS 4439
(61.7 kDa). Isolated IDPs and GFP were expressed
from similar constructs and in the same host cells.
The expression protocol was optimized to obtain
similar amounts of all proteins and to minimize both
the formation of inclusion bodies and spontaneous
proteolysis. Indeed, it has been observed that IDPs are
prone to undergo proteolytic degradation during puri-
fication even upon addition of protease inhibitors to
cell extracts [5]. The culture conditions found to satisfy
all these requirements were: transformed Escherichia
coli BL21 [DE3] cells were grown at 37 °C until D
600
of 0.4–0.5 was reached, then induced with 100 lm of
isopropyl thio-b-d-galactoside at 37 °C for 2 or 6 h,
depending on whether single or fusion proteins were to
be expressed, respectively. Under the above conditions,
all proteins were found to be mainly soluble and prote-
olytic events were negligible (Fig. 2). Despite repeated
attempts (data not shown), we could not improve the
expression level of SIC1-GFP, which systematically
remained very poor. Notably, all the fusion proteins
were fluorescent, thus suggesting that the GFP moiety
adopts a native-like conformation.
Conformational properties of the fusion proteins
vary as a function of the unstructured moiety
NTAIL, PNT and SIC1 have been previously shown
to belong to the family of IDPs on the basis of their
biochemical and biophysical properties [30,32,34].

IDP + GFP mixtures. The CD spectra of NTAIL +
GFP (Fig. 3A) and PNT + GFP (Fig. 3B) mixtures
superimpose quite well onto their respective calculated
theoretical average spectra, indicating that, when the
two separated components are mixed, they do not
undergo any significant structural rearrangement. The
spectra of both NTAIL-GFP and PNT-GFP fusion
proteins are clearly different from those of the mix-
tures either calculated or measured, suggesting that
structural rearrangements are induced in the fusion by
the forced close proximity of the two proteins. In par-
ticular, NTAIL-GFP and PNT-GFP spectra indicate a
lower and higher extent of order with respect to the
average spectra, respectively. By contrast, the spectrum
of the SIC1-GFP fusion protein superimposes onto the
calculated average spectrum, suggesting that the two
domains do not impact on each other’s conformation
Fig. 1. Schematic representation of IDP-GFP constructs. From the
N- to C-terminus, each fusion protein contains the hexahistidine tag
(H
6
), the IDP (NTAIL, PNT or SIC1), a TEV cleavage sequence (TEV)
and the GFP.
Fig. 2. Expression and purification of fused polypeptides and indi-
vidual proteins. M, molecular weight markers; TF, total protein frac-
tion; SOL, soluble protein fraction; proteins purified by immobilized
metal affinity chromatography (IMAC).
Ordered and disordered protein domains I. Sambi et al.
4440 FEBS Journal 277 (2010) 4438–4451 ª 2010 The Authors Journal compilation ª 2010 FEBS
when they are covalently linked. More difficult to

unstructured moiety when the IDP is NTAIL or SIC1,
whereas, in the fusion PNT-GFP, the structured part
appears to prevail, raising the percentage of the differ-
ent secondary structures to a value close to that of
GFP alone (Fig. 4). Comparison between the measured
and the averaged secondary structure contents (see
Materials and methods) clearly shows that the second-
ary structure composition of the fusion proteins devi-
ates from the mean of the single contributions (Fig. 5).
Although this analysis does not allow an assessment of
whether the observed deviations in the structural con-
tent reflect structural transitions taking place in only
one of the two moieties or rather reflect structural
rearrangements distributed over the whole polypeptide,
we can speculate that the increase in order in PNT-
GFP likely reflects a gain of structure within PNT.
That PNT possesses an inherent propensity to undergo
a disorder-to-order transition has already been
reported, with this gain of structure concerning the
first 50 residues [30]. Conversely, the less ordered nat-
ure of the NTAIL-GFP fusion protein with respect to
the mean of the secondary structure contents of the
two components could be ascribed either to partial
unfolding of GFP or to loss of residual structure by
NTAIL, with the transiently populated a-helical
regions of the latter [26,34,36–39] adopting preferen-
tially an extended (e.g. disordered) conformation when
linked to GFP.
A
B

result of steric restrictions, the most likely candidate
for GFP binding is the 183–194 stretch (or the weaker
ones between 214–229 and 253–259) predicted by
anchor.
Regardless of the distribution within the fusion pro-
tein of such folding and unfolding events, we can
clearly state that, in the presence of the same globular
domain (GFP), the overall structure of the fusion pro-
tein varies as a function of the unstructured moiety.
The conformational stability of the chimeras was
investigated by recording variations in the mean resi-
due ellipticity at 195 nm when heating the protein
samples from 20 to 100 °C (Fig. S2). We observed
that, although isolated GFP undergoes a cooperative
unfolding transition between 70 and 90 °C, all IDPs
display almost constant negative mean residue elliptic-
ity values, consistent with the absence of cooperative
unfolding that typifies unstructured proteins, and a
moderate increase of ellipticity at the highest tempera-
tures, consistent with the process of temperature-
induced folding common to several IDPs [41]. Heat
induced transitions recorded for the fusion proteins
were intermediate between these two scenarios. Only
for NTAIL-GFP was a defined transition visible in
the range 75–85 °C range, whereas PNT-GFP and
SIC1-GFP did not display a classical two-state confor-
mational transition. We also monitored the mean resi-
due ellipticity at 195 nm during recooling to 20 °C,
and recorded the CD spectra of the cooled solutions
in the whole range (260–185 nm) to assess the revers-

molecular mass as a result of their relative enrichment
in acidic residues [5]. The apparent M
r
of the isolated
IDPs as observed in SDS ⁄ PAGE was larger than
expected (Table 1), whereas, for GFP, the expected
and observed values were very close. Because all fusion
proteins exhibited an apparent molecular mass
(M
r App
) significantly higher than expected, we con-
cluded that the presence of a covalently linked IDP is
sufficient to affect GFP migration and that the extent
of this modification is correlated with the specific
disordered component, as suggested by the observed
differences in the M
r App
⁄ M
rth
ratio.
We next addressed the impact of the disordered moi-
ety onto the overall compactness of the fusion proteins
by size exclusion chromatography. Because these studies
are quite demanding in terms of protein amounts, we
only focused onto those proteins (NTAIL-GFP and
PNT-GFP) that could be produced and purified in suffi-
cient quantity (Table 1). In gel filtration experiments,
the elution volume of a given protein can be directly cor-
related with the protein apparent molecular mass by
interpolation with a calibration curve in which elution

, a value
closer to the radius expected for a fully denatured state
(R
sU
=35A
˚
) compared to globular protein (R
sN
=
19 A
˚
) [34]. In the present study, PNT (expected mass of
25 kDa) was found to elute with an apparent molecular
mass of 115 kDa, in agreement with previous studies
[30]. This very high value of the apparent molecular
mass corresponds to an observed Stokes radius of 41 A
˚
,
which is closer to the value expected for the fully un-
ordered (R
sU
=46A
˚
) than the globular (R
sN
=23A
˚
)
form. The apparent molecular weight of SIC1 was
reported to be 50 kDa instead of 33 kDa, and the

˚
) is closer to the
R
sN
(28 A
˚
) than to the R
sU
(61 A
˚
), whereas the R
obs
S
of
PNT-GFP ($35 A
˚
) is closer to the R
sN
(31 A
˚
) than to
the R
sU
(69 A
˚
) (Table 1).
Thus, the hydrodynamic values of NTAIL-GFP and
PNT-GFP proteins do not reflect the sum of the
Table 1. Apparent M
r

S
(A
˚
) R
obs
S
⁄ R
sN
R
obs
S
⁄ R
sU
Reference for gel
filtration
NTAIL-GFP 43 51 1.18 96 2.23 28 61 38 ± 2 1.35 0.62 Present study
PNT-GFP 53 64 1.20 73 1.37 31 69 35 ± 2 1.13 0.51 Present study
SIC1-GFP 62 67 1.08 ND
NTAIL 15 20 1.33 36 2.40 19 35 27 ± 2 1.42 0.77 Longhi et al. [34]
PNT 25 34 1.36 115 4.60 23 46 41 ± 2 1.78 0.89 Karlin et al. [30] and
present study
SIC1 33 39 1.18 50 1.51 25 53 30 ± 2 1.20 0.56 Brocca et al. [32]
GFP 29 30 1.03 38 1.31 25 51 27 ± 2 1.08 0.53 Present study
I. Sambi et al. Ordered and disordered protein domains
FEBS Journal 277 (2010) 4438–4451 ª 2010 The Authors Journal compilation ª 2010 FEBS 4443
behaviour of their single components because isolated
NTAIL is less extended than isolated PNT. The struc-
tural disorder and flexibility typical of isolated NTAIL
is maintained and appears to increase in the fusion,
resulting in a Stokes radius that is even higher than

spectra (Fig. 6B) of GFP alone, as well as of GFP
fusion proteins, show a very pronounced negative peak
at 517 nm, with an intensity in the the order: GFP >
PNT-GFP > NTAIL-GFP > SIC1-GFP. This peak
reflects the asymmetric and therefore rigid environment
of the green chromophore. The gradual reduction in
the intensity of the peak in the fusion proteins is indic-
ative of progressive loss of ordered structure as PNT,
NTAIL or SIC1 are added (Fig. 6B).
In conclusion, near and visible CD data are in good
agreement with the data provided by far-UV and size-
exclusion chromatography studies and, taken together,
they converge to show that PNT-GFP is the most
compact and ordered fusion protein, whereas SIC1-
GFP is the most disordered one.
All the results obtained in the present study so far
point to reciprocal and different effects of the two moie-
ties of the fusion. However, they still do not unravel
whether one of the two domains is more affected in its
conformation; in other words, whether order prevails
on disorder or vice versa. In an attempt to assign these
effects to a specific domain, we analyzed changes in
GFP fluorescence and resistance to proteolysis of the
fusion proteins.
GFP stability is not affected by fusion with the
disordered domain, whereas IDPs are only
marginally protected from proteolysis by the
linked GFP
The presence of a natural chromophore in the globular
part of the fusion provides a sensitive probe for assess-

GFP stability, at least in the protein regions around the
chromophore or critical for its stabilization, and is in
agreement with the results of the spectroscopic analyses
described above, where the GFP moiety, both alone and
IDP-linked, proved unable to recover its native confor-
mation after thermal unfolding.
Globular proteins are rather resistant to proteases,
whereas the extended structure of IDPs makes them
prone to proteolytic attacks [4,5,41,44,45]. For this rea-
son, and in view of understanding which domain is
affected by structural rearrangements, we assessed
whether the presence of GFP is able to protect the
unstructured part of the fusion or, in contrast, GFP
becomes more protease-accessible when linked to an
IDP. In Fig. 8, we show a time-course analysis of a
limited tryptic digestion of NTAIL-GFP and PNT-
GFP, as well as of their isolated IDP moieties. In these
experiments, GFP was very resistant to degradation
even with enzyme : substrate molar ratios as high as
1 : 40 and an incubation time of up to 1 h (data not
shown), whereas both IDPs started to degrade after
1 min of tryptic digestion, and were no longer detect-
able after 5 min (Fig. 8). A significant degradation of
NTAIL was already apparent in the absence of the
enzyme (t
0
in Fig. 8A), consistent with a high prote-
ase-susceptibility of this protein. Interestingly, a
fragment of the same apparent molecular mass
(approximately 17 kDa) was also observed in the sam-

digestion (Fig. 8A, box a).
Isolated PNT migrated as a unique band in the con-
trol sample but underwent fast degradation upon tryp-
tic treatment with disappearance of the full-length
polypeptide as early as after 5 min of incubation. Pro-
teolysis of PNT-GFP proceeded with the formation of
a relatively stable fragment with an apparent mass of
31 kDa (Fig. 8B, box b), in addition to that corre-
sponding to GFP alone, already after 1 min of incuba-
tion (Fig. 8B).
Persistent protein fragments (see ‘framed’ bands a
and b in Fig. 8) were processed by tryptic in-gel diges-
tion and the resulting peptides were analyzed by
MS ⁄ MS (Fig. S3). The M
r
, as determined by MS, of
band a from NTAIL-GFP was 31.6 kDa and that of
band b from PNT-GFP was 30.8 kDa. Sequencing
showed that these protease-resistant fragments encom-
pass the trypsin cutting sites at position 128 in
NTAIL-GFP and at positions 226, 235 and 236 of
PNT-GFP, respectively. These results indicate that the
complete proteolytic digestion of both IDPs requires
longer incubation when they are fused with GFP, with
a proteolytic fragment still containing part of the IDP
being detectable after as long as 60 min of incubation
in both cases (Fig. 8). That the GFP sensitivity
towards proteolysis was not affected by its linkage to
an unstructured part was checked in two additional
experiments. Western blotting analysis of a time-

other?
In conclusion, we have observed that different IDPs
fused to the same globular protein result in polypep-
tides with distinctive secondary structure content and
compactness that are not merely the average of their
two components. The finding that their overall struc-
ture and compactness are not consistent with those
that are predicted on the basis of the behaviour of the
isolated IDP was intriguing. Indeed, although PNT
alone is more flexible than NTAIL, PNT-GFP is by
far more structured and compact that the NTAIL
fusion. This observation may suggest that linkage with
GFP confers the two IDPs with folding propensities
that differ from those of the isolated NTAIL and PNT
proteins. Nonetheless, our attempts to highlight spe-
cific structural rearrangements within either the IDP or
the GFP moiety that could account for the specific
conformational features observed were hindered by the
complex nature of proteins. Association with a disor-
dered moiety left GFP almost unchanged, whereas the
IDP was marginally stabilized towards proteolysis.
However, despite the higher compactness of the PNT-
GFP fusion protein with respect to NTAIL-GFP, no
higher proteolytic resistance of PNT-GFP could be
detected. It could be speculated that the high flexibility
of IDPs prevents the formation of stable interactions,
causing delocalized structural rearrangements that
failed to manifest in the experiments conducted in the
present study.
Materials and methods

ATTGCTTGCAGCC-3¢) that introduced a silent mutation
at nucleotide position 321 resulting in the suppression of
the NcoI site. Product N
2
was amplified with a forward pri-
mer (FWN
2
:5¢-GGCTGCAAGCAATGGCAGG-3¢) that
introduced the same silent mutation as above at nucleotide
position 321 and a reverse primer (REVN
2
:5¢-ATCGCC
ATGGTCCCGGGCATATGGGATCCCTGGAAGTACA
GGTTTTCGTCTAGAAGATTTCTGTC-3¢) designed to
remove the NTAIL stop codon and to introduce a fragment
encoding a TEV cleavage sequence and a NcoI restriction
site at position +38 after the end of the NTAIL sequence.
N
1
and N
2
were mixed, digested with DpnI to remove the
methylated DNA template, and used as the template in a
PCR reaction with primers FWN
1
and REVN
2
to yield the
complete NTAIL amplification product.
The DNA fragment encoding PNT with an N-terminal

and 2 min at 72 °C were performed, followed by a final
elongation step of 10 min at 72 °C.
All PCR products (NTAIL, PNT and SIC1) were
digested with DpnI and purified by precipitation with
ethanol, restricted with ClaI and NcoI, checked by agarose
(0.8%, w ⁄ v) gel electrophoresis and purified from the gel
(QIAquick Gel Extraction Kit; Qiagen, Valencia, CA,
USA). The pET22 vector was digested with NdeI, filled-in
with the Klenow fragment of the E. coli DNA polymerase I
(New England Biolabs, Beverly, MA, USA) to produce
blunt ends, and finally cleaved with NcoI. In this way, the
sequence pelB, allowing targeting to the periplasm of pro-
teins expressed from pET22, was removed. The digested
PCR products and pET22 were ligated with T4 Ligase
(New England Biolabs). The final constructs are referred to
as pET ⁄ NTAIL, pET ⁄ PNT and pET ⁄ SIC1.
The GFP gene (cloned from a pET19b ⁄ GFP plasmid)
was then inserted downstream NTAIL, PNT and SIC1 at
the NcoI and ScaI sites to obtain pET ⁄ NTAIL-GFP,
pET ⁄ PNT-GFP and pET ⁄ SIC1-GFP. These constructs
encode for fusion proteins bearing a 14 residues linker
containing the TEV cleavage sequence between the two
components. The final constructs were transformed into
the E. coli DH5a strain (Novagen) and the sequence of
their ORFs was checked by DNA sequencing on both
strands.
Expression and purification of fusion proteins
The E. coli BL21[DE3] strain (Novagen) was used as the
host for heterologous expression. Transformed cells were
grown overnight at 37 °C in low-salt LB medium contain-

imidazole. When required, buffer exchange was performed
by gel filtration on PD-10 columns (GE Healthcare, Mil-
waukee, WI, USA) and samples were concentrated with a
I. Sambi et al. Ordered and disordered protein domains
FEBS Journal 277 (2010) 4438–4451 ª 2010 The Authors Journal compilation ª 2010 FEBS 4447
Microcon
Ò
Ultra-15 centrifugal filter device (molecular
mass cut-off, 10 000 Da) (Millipore Corp., Billerica, MA,
USA).
Protein fractions were analyzed on 12% polyacrylamide
gels stained by GelCode Blue (Pierce, Rockford, IL, USA).
Proteins concentration was determined with the Bradford
assay using BSA as the standard.
CD
The CD spectra of proteins (0.1–0.2 mgÆmL
)1
for far-UV
measurements and 1 mgÆmL
)1
for near-UV and visible mea-
surements) in 10 mm sodium phosphate buffer (pH 7.5)
were recorded on a J-815 spectropolarimeter (Jasco Corp.,
Easton, MD, USA), using either a 1 mm or 1 cm path-
length quartz cuvette for far-UV or for near-UV and visible
domains, respectively. A Peltier thermoregulation system
was used when recording the spectra. All the experiments
were performed in triplicate. Denaturation ⁄ renaturation
spectra were obtained measuring the CD signal at a fixed
wavelength (195 nm) when progressively heating from 20 to

[h]
Ave
, expected for a protein mixture in which no second-
ary structure rearrangements take place upon mixing
equimolar amounts of protein 1 and protein 2 were calcu-
lated as:
½h
Ave
¼
fð½h
1
Á n
1
Þþð½h
2
Á n
2
Þg
ðn
1
þ n
2
Þ
where [h]
1
and [h]
2
correspond to the measured mean ellip-
ticity values per residue of proteins 1 and 2, respectively,
and n

the number of residues, m
1
or m
2
is the molecular mass
(Da), and c
1
or c
2
is the protein concentration (mgÆmL
)1
)
for proteins 1 and 2, respectively.
The experimental data were then analyzed using the
cdsstr software (http://dichroweb.cryst.bbk.ac.uk/html/
home.shtml) using SDP42 as the reference dataset. The
cdsstr deconvolution method was used to estimate the
content of a-helices, b-strands, b-turns and unordered
regions of individual and fusion proteins. The secondary
structure composition expected for fusion proteins with no
reciprocal structural impact was obtained by averaging the
content of a-helices, b-strands, b-turns and unordered
regions of the individual intrinsically unstructured proteins
and GFP moieties.
Analytical gel filtration and calculation of Stokes
radii
Gel filtration was performed on an A
¨
KTA purifier liquid-
chromatography system (GE Healthcare), using a pre-

¼ð0:533  log M
r
ÞÀ0:682 ð2Þ
where M
r
is the molecular mass (as inferred from the amino
acid sequence). M
r
was calculated using the protparam
tool at the expasy server (http://www.expasy.ch/tools). The
experimentally observed Stokes radii (R
obs
S
) were deduced
by inserting the apparent M
r
(as observed in gel filtration
experiments) in Eqn (1).
Ordered and disordered protein domains I. Sambi et al.
4448 FEBS Journal 277 (2010) 4438–4451 ª 2010 The Authors Journal compilation ª 2010 FEBS
Fluorescence spectroscopy
Fluorescence emission of the GFP chromophore was mea-
sured by using a Cary Eclipse (Varian Inc., Palo Alto, CA,
USA) spectropolarimeter using 1 · 1 cm quartz cuvette
containing 1 lm protein in 10 mm sodium phosphate (pH
7.5). For spectra at 20 °C, the excitation wavelength was
474 nm and the emission spectra were recorded in the range
465–620 nm. Using the same excitation wavelength
(474 nm), thermal denaturation studies were performed by
recording fluorescence emission at 527 nm when heating

Applied Biosystems, Foster City, CA, USA) equipped with
a nano-electrospray ionization sample source. Metal-coated
borosilicate capillaries (Proxeon, Odesnse, Denmark) with a
medium-length emitter tip of 1 lm internal diameter were
used. The instrument was calibrated with a standard solu-
tion of renin (Applied Biosystems). Spectra of tryptic pep-
tides were acquired in the range 500–1500 m ⁄ z, at room
temperature, with an accumulation time of 1 s, ion-spray
voltage of 1300 V and declustering potential of 60 V, with
application of active information-dependent acquisition,
using rolling collision energy to fragment peptides for
MS ⁄ MS analysis. Peptide identification was performed
using mascot software (Matrix Science Ltd, London, UK)
with the parameters: two trypsin missed cleavages; peptide
tolerance, 0.6 Da; MS ⁄ MS tolerance, 0.6 Da; peptide
charges, 2+ and 3+. Only monoisotopic masses were con-
sidered as precursor ions.
Acknowledgements
I.S. acknowledges financial support from the EXTRA
programme of UNIMIB-Cariplo, allowing her to carry
out part of this work in Marseille. The authors wish to
thank Antonino Natalello and Silvia Maria Doglia for
their assistance with the fluorescence spectroscopy, as
well as for critically reading the manuscript. We are
indebted to Maria Samalikova for performing the mass
spectrometry. We also wish to thank the anonymous
reviewer who suggested carrying out near-UV and visi-
ble CD experiments. This work was supported by a
grant from the University Milano-Bicocca (Fondo di
Ateneo per la Ricerca) to M.L. and by a grant

its implication in dynamic interactions of proteins.
FEBS J 276, 5406–5415.
I. Sambi et al. Ordered and disordered protein domains
FEBS Journal 277 (2010) 4438–4451 ª 2010 The Authors Journal compilation ª 2010 FEBS 4449
10 Iakoucheva LM, Brown CJ, Lawson JD, Obradovic Z
& Dunker AK (2002) Intrinsic disorder in cell-signaling
and cancer-associated proteins. J Mol Biol 323, 573–584.
11 Cheng Y, LeGall T, Oldfield CJ, Dunker AK &
Uversky VN (2006) Abundance of intrinsic disorder in
protein associated with cardiovascular disease. Biochem-
istry 45, 10448–10460.
12 Chiti F & Dobson CM (2006) Protein misfolding, func-
tional amyloid, and human disease. Annu Rev Biochem
75, 333–366.
13 Dyson HJ & Wright PE (2005) Intrinsically unstruc-
tured proteins and their functions. Nat Rev Mol Cell
Biol 6, 197–208.
14 Meszaros B, Simon I & Dosztanyi Z (2009) Prediction
of protein binding regions in disordered proteins. PLoS
Comput Biol 5, e1000376.
15 Radhakrishnan I, Perez-Alvarado GC, Parker D,
Dyson HJ, Montminy MR & Wright PE (1997) Solu-
tion structure of the KIX domain of CBP bound to the
transactivation domain of CREB: a model for
activator:coactivator interactions. Cell 91, 741–752.
16 Oldfield CJ, Meng J, Yang JY, Yang MQ, Uversky VN
& Dunker AK (2008) Flexible nets: disorder and
induced fit in the associations of p53 and 14-3-3 with
their partners. BMC Genomics 9(Suppl 1), S1.
17 Uversky VN, Oldfield CJ, Midic U, Xie H, Xue B,

Conformation of the helical nucleocapsids of paramyx-
oviruses and vesicular stomatitis virus: reversible coiling
and uncoiling induced by changes in salt concentration.
Proc Natl Acad Sci USA 77, 2631–2635.
25 Bourhis JM, Johansson K, Receveur-Brechot V,
Oldfield CJ, Dunker KA, Canard B & Longhi S (2004)
The C-terminal domain of measles virus nucleoprotein
belongs to the class of intrinsically disordered proteins
that fold upon binding to their physiological partner.
Virus Res 99, 157–167.
26 Gely S, Lowry DF, Bernard C, Jensen MR, Blackledge
M, Costanzo S, Bourhis JM, Darbon H, Daughdrill G
& Longhi S (2010) Solution structure of the C-terminal
X domain of the measles virus phosphoprotein and
interaction with the intrinsically disordered C-terminal
domain of the nucleoprotein. J Mol Recognit 23, 435–
447.
27 Zhang X, Bourhis JM, Longhi S, Carsillo T, Buccellato
M, Morin B, Canard B & Oglesbee M (2005) Hsp72
recognizes a P binding motif in the measles virus N
protein C-terminus. Virology 337, 162–174.
28 Couturier M, Buccellato M, Costanzo S, Bourhis JM,
Shu Y, Nicaise M, Desmadril M, Flaudrops C, Longhi
S & Oglesbee M (2010) High affinity binding between
Hsp70 and the C-terminal domain of the measles virus
nucleoprotein requires an Hsp40 co-chaperone. J Mol
Recognit 23, 301–315.
29 Iwasaki M, Takeda M, Shirogane Y, Nakatsu Y,
Nakamura T & Yanagi Y (2009) The matrix protein
of measles virus regulates viral RNA synthesis and

X, Buccellato M, Darbon H, Canard B, Finet S &
Longhi S (2005) The intrinsically disordered C-terminal
domain of the measles virus nucleoprotein interacts with
the C-terminal domain of the phosphoprotein via two
distinct sites and remains predominantly unfolded.
Protein Sci 14, 1975–1992.
37 Morin B, Bourhis JM, Belle V, Woudstra M, Carriere F,
Guigliarelli B, Fournel A & Longhi S (2006) Assessing
induced folding of an intrinsically disordered protein by
site-directed spin-labeling electron paramagnetic reso-
nance spectroscopy. J Phys Chem B 110, 20596–20608.
38 Belle V, Rouger S, Costanzo S, Liquiere E, Strancar J,
Guigliarelli B, Fournel A & Longhi S (2008) Mapping
alpha-helical induced folding within the intrinsically dis-
ordered C-terminal domain of the measles virus nucleo-
protein by site-directed spin-labeling EPR spectroscopy.
Proteins 73, 973–988.
39 Kavalenka A, Urbancic I, Belle V, Rouger S, Costanzo
S, Kure S, Fournel A, Longhi S, Guigliarelli B & Stran-
car J (2010) Conformational analysis of the partially
disordered measles virus N(TAIL)-XD complex by
SDSL EPR spectroscopy. Biophys J 98, 1055–1064.
40 Dosztanyi Z, Meszaros B & Simon I (2009) ANCHOR:
web server for predicting protein binding regions in
disordered proteins. Bioinformatics 25, 2745–2746.
41 Uversky VN (2002) Natively unfolded proteins: a point
where biology waits for physics. Protein Sci 11, 739–756.
42 Receveur-Brechot V, Bourhis JM, Uversky VN, Canard
B & Longhi S (2006) Assessing protein disorder and
induced folding. Proteins 62, 24–45.

copy-edited or typeset. Technical support issues arising
from supporting information (other than missing files)
should be addressed to the authors.
I. Sambi et al. Ordered and disordered protein domains
FEBS Journal 277 (2010) 4438–4451 ª 2010 The Authors Journal compilation ª 2010 FEBS 4451