Báo cáo khoa học: Reconstitution in vitro of the GDP-fucose biosynthetic pathways of Caenorhabditis elegans and Drosophila melanogaster - Pdf 11

Reconstitution in vitro of the GDP-fucose biosynthetic
pathways of Caenorhabditis elegans and Drosophila
melanogaster
Simone Rhomberg
1
, Christina Fuchsluger
1
, Dubravko Rendic
´
1
, Katharina Paschinger
1
,
Verena Jantsch
2
, Paul Kosma
1
and Iain B. H. Wilson
1
1 Department fu
¨
r Chemie, Universita
¨
tfu
¨
r Bodenkultur, Vienna, Austria
2 Abteilung fu
¨
r Chromosomenbiologie, Vienna Biocenter II, Austria
Fucose is a key component of many oligosaccha-
rides involved in recognition events and therefore

¨
tfu
¨
r Bodenkultur, Muthgasse 18,
A-1190 Vienna, Austria
Fax: +43 1 36006 6059
Tel: +43 1 36006 6541
E-mail:
Database
The nucleotide sequences of C. elegans and
D. melanogaster gmd and ger cDNA have
been submitted to the EMBL database
under accession numbers AM231683,
AM231684, AM231685, AM231686,
AM231687 and AM231688
(Received 30 November 2005, revised 17
February 2006, accepted 20 March 2006)
doi:10.1111/j.1742-4658.2006.05239.x
The deoxyhexose sugar fucose has an important fine-tuning role in regula-
ting the functions of glycoconjugates in disease and development in mam-
mals. The two genetic model organisms Caenorhabditis elegans and
Drosophila melanogaster also express a range of fucosylated glycans, and
the nematode particularly has a number of novel forms. For the synthesis
of such glycans, the formation of GDP-fucose, which is generated from
GDP-mannose in three steps catalysed by two enzymes, is required. By
homology we have identified and cloned cDNAs encoding these two pro-
teins, GDP-mannose dehydratase (GMD; EC 4.2.1.47) and GDP-keto-6-
deoxymannose 3,5-epimerase ⁄ 4-reductase (GER or FX protein; EC
1.1.1.271), from both Caenorhabditis and Drosophila. Whereas the nema-
tode has two genes encoding forms of GMD (gmd-1 and gmd-2) and one

opsis thaliana [17–19], Escherichia coli [20], Helicobact-
er pylori [21,22] and Paramecium bursaria Chlorella
virus 1 [23]. Indeed Arabidopsis has two GMD genes,
one of which corresponds to the MUR1 ⁄ GMD2 gene,
a defect in which results in deficiencies in cell wall bio-
synthesis [24]. GMD is also defective in the Chinese
hamster ovary Lec13 and murine lymphoma PL
R
1.3
mutant cell lines, and this absence results in resistance
to fucose-specific lectins [25,26]. Mice defective in
GER suffer from postnatal failure to thrive and an
absence of leukocyte selectin ligand expression [27],
whereas mutant strains of both the intestinal symbiont
Bacteriodes and the nodulation symbiont Sinorhizo-
bium fredii unable to produce GDP-Fuc display
reduced colonization competitiveness in the presence
of wild-type strains [28,29]. There also exists a Dicytos-
telium discoideum (slime mould) strain (HL250) with a
genetically undefined defect in the conversion of GDP-
Man into GDP-Fuc and a resultant reduced germina-
tion efficiency for older spores, suggesting that, as for
the aforementioned bacterial symbionts, the presence
of fucose may confer a selective advantage under
natural conditions [30]. However, although early stud-
ies were taken to suggest that GMD may be defective
in patients with leukocyte adhesion deficiency II
(OMIM 266265) [31,32], it now appears to be accepted
that mutations in the GDP-Fuc transporter are the
reason for the observed reduction in fucosylation

different 5¢ exons (the second and smaller form,
C53B4.7a, which is designated gmd-1a in this study);
both 5¢ -end gmd-1a EST clones in the databases contain
an SL1 spliced leader. In the case of the second worm
gene, encoding GMD-2, RT-PCR using a forward pri-
mer containing the predicted start codon was unsuccess-
ful, as was PCR using forward primers corresponding to
the SL1 or SL2 spliced leaders and gmd-2-specific
reverse primers. Finally, gmd-2 was cloned in an incom-
plete form starting with the second exon, which, how-
ever, still contains the first region (Gly-Leu-Glu)
conserved in comparison with the gmd-1 cDNAs.
As for GMD, homologues of the human GER pro-
tein were identified from Caenorhabditis and Droso-
phila, and the relevant cDNAs cloned; we also cloned
both Arabidopsis homologues. The Drosophila homo-
logue has already been named gmer (CG3495) [36],
whereas the Caenorhabditis ger-1 corresponds to the
R01H2.5 reading frame. As for the GMD enzymes,
alignments show a high degree of conservation
between GER homologues (Fig. 2).
Enzymatic activity of GMD and GER proteins
All Arabidopsis, Caenorhabditis and Drosophila GMD
and GER homologues were expressed using the
S. Rhomberg et al. GDP-fucose biosynthesis in invertebrates
FEBS Journal 273 (2006) 2244–2256 ª 2006 The Authors Journal compilation ª 2006 FEBS 2245
pET30a system in the presence of kanamycin and chlo-
ramphenicol; in addition, a pCRT7-NT vector carrying
Caenorhabditis gmd-1 was also coexpressed with the
pET30a clone of Caenorhabditis ger-1 in the presence

The assays were performed using GDP-Man as sub-
strate; incubations were performed with extracts con-
taining either of the Arabidopsis, Caenorhabditis or
Drosophila enzymes alone or with both enzymes from
the various species together. The incubations were then
analysed by RP-HPLC, using authentic GDP-Man
and GDP-Fuc as external standards. Initially, 0.5 m
KH
2
PO
4
was used as eluent [37], but, analogous to the
use of ammonium formate buffers for the purification
of UDP-xylose [38], it was then decided to examine the
use of the formate buffer. As the results with the two
buffers were comparable, all subsequent analyses were
performed with the volatile formate buffer. Further-
more, it was not absolutely necessary to perform the
GMD reaction before boiling and then adding GER;
such a procedure, though, has been described for
assays with E. coli K12 Gmd and WcaG [39].
When GMD ⁄ GER ‘pairs’ of any one of the three
species were present, a component that was coeluted
with standard GDP-Fuc was produced (Fig. 4). In the
case of the Arabidopsis MUR1 and GER1 enzymes, the
putative GDP-Fuc product was shown to be a donor
substrate in fucosyltransferase assays (data not shown).
GDP-Fuc synthesis was also observed when either the
Arabidopsis MUR1 or the Caenorhabditis GMD-1a iso-
form were incubated with Caenorhabditis GER-1 and

detected on expression at 37 °C, whereas for the Caenor-
habditis enzymes, only minimal activity was found on
expression at 16 °C. GDP-Fuc synthesis on coexpres-
sion of Caenorhabditis GMD-1 and GER-1 was margin-
ally less efficient (12%) than synthesis in the presence of
both separately expressed enzymes (15–20%) assayed
under the same conditions; thus, there is no obvious
requirement to coexpress GMD and GER. This is unlike
the situation with expression of the Arabidopsis MUR1
in yeast, as in this system MUR1 was susceptible to
degradation when not coexpressed with GER1 [37].
Fig. 4. Activity of expressed GMD and GER isoforms. The soluble
fractions of lysates (equal lysate equivalents) of bacteria expressing
GMD and GER enzymes were incubated overnight with GDP-Man
and subjected to RP-HPLC. The chromatograms of the following
combinations are shown: (A) Drosophila GMD alone; (B) Drosophila
GMER alone; (C) Drosophila GMD and GMER; (D) Caenorhabditis
GMD-1a; (E) Caenorhabditis GMD-1 and GER-1; (F) Caenorhabditis
GMD-2 and GER-1; (G) Arabidopsis MUR1 (GMD2) and GER1; (H)
Arabidopsis GMD1 and GER2. The elution positions of GDP-Man
and GDP-Fuc standards are indicated. In the experiments shown,
the GMD and GER isoforms were expressed separately.
GDP-fucose biosynthesis in invertebrates S. Rhomberg et al.
2248 FEBS Journal 273 (2006) 2244–2256 ª 2006 The Authors Journal compilation ª 2006 FEBS
In addition to using MUR1 and GER1 as controls,
we also examined the other Arabidopsis homologues
of these enzymes, respectively, GMD1 and GER2.
Whereas GMD1 has been previously shown to be active
[18], GER2 was only identified in silico as a putative
epimerase-reductase [19]. The assay data showed that,

for the synthesis of GDP-Fuc by Aerobacter aerogenes
and CHO cell extracts [25,41], whereas both the sepa-
rately assayed GMD and GER from porcine thyroid
show optima at pH  7 [42,43] and recombinant forms
of human and E. coli GMD have optima of pH 7.5–
8.0 [32,44]. The recombinant E. coli K-12 GER enco-
ded by the wcaG gene was most active in the range
pH 6–7 [45].
As regards temperature, the Drosophila enzymes
were most active at temperatures of 16–30 °C, whereas
the Caenorhabditis enzymes (specifically GMD-1 and
GER-1) displayed a temperature optimum of 23–37 °C
(Fig. 5). Assays with recombinant GDP-mannose
dehydratases alone showed that both Caenorhabditis
GMD-1a and Drosophila GMD had temperature
optima  30 °C, whereas Caenorhabditis GMD-2 was
most active at 16–23 °C (data not shown).
Purification of Drosophila GMD and GMER
In the preceding studies, the identity of the GDP-Fuc
product was based on HPLC retention time; thus, it
was decided to purify the product of the fruitfly pro-
teins for further analysis. Thus Drosophila GMD and
GMER were subjected to nickel-chelation chromato-
graphy either separately or together and isolated after
elution with 250 mm imidazole (Fig. 6, upper panel).
The dominant bands (35 kDa and 50 kDa, corres-
ponding to GMER and GMD, respectively) eluted
with the latter buffer reacted with an antibody to His
(Fig. 6, lower panel), and their identity was verified by
MALDI-TOF tryptic peptide mapping. Protein assays

% Relative yield
Fig. 5. Relative yield of GDP-Fuc with respect to incubation tem-
perature. Assays of Arabidopsis MUR1 and GER1, Drosophila GMD
and GMER, and Caenorhabditis GMD-1 and GER-1 were performed
at different temperatures, and the relevant RP-HPLC peaks were
integrated. The data were then recalculated individually for each
enzyme pair relative to the respective activity at 23 °C.
S. Rhomberg et al. GDP-fucose biosynthesis in invertebrates
FEBS Journal 273 (2006) 2244–2256 ª 2006 The Authors Journal compilation ª 2006 FEBS 2249
FucTA was used as an enzyme source as judged by the
conversion of the dabsyl-GnGnF
6
glycopeptide sub-
strate into a species with an m ⁄ z 146 higher (data not
shown). Furthermore, the compound was subjected to
NMR, which confirmed its identity as GDP-Fuc
(Table 1), the data matching those reported for syn-
thetic GDP-Fuc [46].
Developmental expression profile in
Caenorhabditis
Considering the multiplicity of genes and transcripts
encoding GDP-mannose dehydratase in C. elegans,
semi-normalized RT-PCR was performed using cDNA
from L1 larvae, L2 ⁄ 3 larvae (combined as these are
difficult to distinguish), L4 larvae and adults. The
results (Fig. 7) would suggest minor variations in the
concentrations of the gmd-2 and ger-1 transcripts dur-
ing worm development. A peak of gmd-1 transcription
may be occurring in the L2 ⁄ 3 stage, but transcripts of
this form are seemingly under-represented in adults.

J (Hz) J
PP
20.5, J
HP
8.0
P-5-Rib
31
P ) 10.8
Guanine
1
H 8.13
13
C 138.48
Fig. 7. Development RT-PCR profile for GMD and GER transcripts
in Caenorhabditis. RT-PCR was performed using RNA isolated from
L1, L2 ⁄ L3, L4 and adult C. elegans using primers specific for
gmd-1, gmd-1a (alternatively spliced form of GMD-1), gmd-2 and
ger-1. The amounts of cDNA used in the PCRs were normalized on
the basis of the intensity of actin transcripts.
GDP-fucose biosynthesis in invertebrates S. Rhomberg et al.
2250 FEBS Journal 273 (2006) 2244–2256 ª 2006 The Authors Journal compilation ª 2006 FEBS
On the other hand, the alternatively spliced gmd-1a
transcript is present at its lowest concentrations in L1
larvae and is relatively more abundant in the later sta-
ges. The expression of the GDP-Fuc biosynthesizing
enzymes throughout development is compatible with
the rich variety of fucosylated N-glycans and O-gly-
cans in this species [47,48].
Discussion
GDP-fucose was first found in 1958 [49], and its bio-

Drosophila has no genetically detectable ‘salvage’
pathway. Plants and mammals do have relevant
homologues, although the putative plant ‘salvage’
pathway is seemingly closer to that of Bacteriodes,
as plant genomes contain homologues of the fkp
gene from Bacteriodes, a gene that encodes a protein
with both fucokinase and GDP-Fuc phosphorylase
activities [28]. In mammals, however, these activities
are encoded by separate genes. Caenorhabditis
appears, on the other hand, only to have an obvious
fucokinase homologue (C26D10.4). In addition,
GMD is also required for the de novo synthesis of
GDP-Rha in Ps. aeruginosa, as the product of
GMD, GDP-4-keto-6-deoxy-d-mannose, can also be
acted on by a reductase [56], whereas the GMD of
the P. bursaria Chlorella virus 1 can directly convert
GDP-4-keto-6-deoxy-d-mannose into GDP-Rha [23].
Thus it is conceivable that GMD is more ancient
than GER.
The GMD and GER sequences across the various
kingdoms of life are remarkably highly conserved;
both proteins are members of the short chain dehy-
drogenase (SDR) family and display homologies to
other enzymes of sugar nucleotide metabolism, such as
dTDP-glucose dehydrogenase, UDP-Gal epimerase
and UDP-GlcA decarboxylase. Phylogenetic trees (not
shown) suggest that the plant enzymes are closer to
the bacterial, than to the animal, ones; regardless of
this, however, residues found by crystallographic or
mutagenesis studies to be important for binding or

more, the presence of duplicated genes means that
knocking-out one GMD, i.e. MUR1, does not totally
diminish the fucose content of Arabidopsis glycoconju-
gates [24]. Any strategy to abolish all fucosylation in
plants is possibly also complicated by the presence of
the aforementioned fkp homologue. On the other hand,
Drosophila has only one GMD and one GER homo-
logue; indeed, a GMD mutation has been isolated and
is lethal at the third larval stage [62], commensurate
S. Rhomberg et al. GDP-fucose biosynthesis in invertebrates
FEBS Journal 273 (2006) 2244–2256 ª 2006 The Authors Journal compilation ª 2006 FEBS 2251
with the putative key role for peptide O-fucosyl-
transferases in development and the probable lack of
any salvage pathway.
C. elegans, however, is somewhere between these
extremes, as it has two GMD enzymes (although the
related nematode Caenorhabditis briggsae appears to
have only one gmd gene, suggesting that the duplication
of gmd genes is an evolutionarily relatively recent event),
whose activities were proven in the course of our studies,
but only one GER isoform. Suggestive of functional
degeneracy are RNAi data on the two Caenorhabditis
GMD homologues: at least when performed individu-
ally, as part of a large-scale screen, RNAi of gmd-1,
gmd-2 and ger-1 resulted in no obvious associated lethal-
ity. However, in another large-scale RNAi screen with
the hypersensitive rrf-3 worm strain, various defects
were indeed reported upon knock-down of gmd-2 [63];
no data, however, on gmd-1 or gmd-1a were reported in
the study using rrf-3 worms, so neither the relative

characterization of these enzymes lends confidence to
any subsequent reverse genetic or phylogenetic studies
or in the use of conditional mutants and lays the foun-
dation for future work on the role of fucose in the
biology of these model organisms.
Experimental procedures
Cloning of GMD and GER cDNAs
RNA was extracted from A. thaliana (Columbia), C. elegans
(N2) or D. melanogaster (Canton S) using Trizol reagent
(Invitrogen, Paisley, UK). Two-step RT-PCR was performed
using Superscript III reverse transcriptase (Invitrogen) and
Table 2. Primers used in this study.
AtGMD1 AtGMD1 ⁄ 1 ⁄ NcoI, CATGCCATGGCCTCCAGATCTCTC (fwd)
AtGMD1 ⁄ 2 ⁄ EcoRI, CGGAATTCAAGGTCGTGCTGAGCTC (rev)
AtMUR1 AtMUR1 ⁄ 1 ⁄ NcoI, CATGCCATGGCGTCAGAGAACAACGG (fwd)
AtMUR1 ⁄ 2 ⁄ XhoI, ACCCTCGAGTCAAGGTTGCTGCTTAGC (rev)
AtGER1 AtGER1 ⁄ 1 ⁄ NcoI, CATGCCATGGCTGACAAATCTGCC (fwd)
AtGER1 ⁄ 2 ⁄ XhoI, ACCCTCGAGTTATCGGTTGCAAACATTCTT (rev)
AtGER2 AtGER2 ⁄ 1 ⁄ NcoI, CATGCCATGGAATCAGGTTCGTTTATGTTA (fwd)
AtGER2 ⁄ 2 ⁄ XhoI, CCGCTCGAGTTACTGCTTCTTCTGCACAA (rev)
CeGMD-1 CeGMD1 ⁄ 1 ⁄ NcoI, CATGCCATGGCAACCGGCAAGTCTG (fwd),
CeGMD ⁄ 1 ⁄ BamHI, CGGGATCCAATGCCAACCGGCAAGTCTG (fwd),
or CeGMD1a ⁄ 1 ⁄ NcoI, CATGCCATGGCTGATCAAAATGCGAA (fwd)
CeGMD1 ⁄ 2 ⁄ HindIII, CCCAAGCTTAAGCCATTGGATTGGACTTC (rev)
CeGMD-2 CeGMD2 ⁄ 3 ⁄ NcoI, CATGCCATGGGTCTCGAATCATGTATTGA (fwd)
CeGMD2 ⁄ 1 ⁄ BamHI, CGGGATCCTAAGCCATTGGATCTGCC (rev)
CeGER-1 CeGER ⁄ 1 ⁄ NcoI, CATGCCATGGCTAAAACTATTCTAGTTACT (fwd)
CeGER ⁄ 2 ⁄ EcoRI, CGGAATTCTTATTTTCTAGCCGTCTCATAA (rev)
DmGMD DmGMD ⁄ 1 ⁄ BamHI, CGGGATCCATGCTAAATACCCGGC (fwd)
DmGMD ⁄ 2 ⁄ XhoI, CCGCTCGAGTTAAGCGATTGGATTTTTCCT (rev)

23 °C for up to three hours.
Cells were resuspended in 500 lL (small-scale) or 5 mL
(large-scale) lysis buffer containing 50 mm Tris, 400 mm
NaCl, 100 mm KCl, 10% glycerol, 0.5% Triton X-100,
10 mm imidazole, pH 7.8, and lysed by performing repeated
freeze–thaw cycles, using alternately a methanol bath and a
42 °C water bath. DNase I was added, and the lysates were
incubated for 10 min at 37 ° C before centrifugation for
1 min (small-scale) or 20 min (large-scale) at 14 000 g,
4 °C. The supernatant was taken for assays or, in the case
of large-scale cultures, purification. For the presented data,
the cells were always grown and lysed under the same con-
ditions (i.e. same initial cell density, temperature, time of
induction and concentration of isopropyl b-d-thiogalacto-
side). Aliquots of these lysates stored at )80 °C still dis-
played activity after 1 year of storage.
Purification by nickel-chelation chromatography
The supernatants from lysed cells were incubated with 2 mL
Ni ⁄ nitrilotriacetate resin (Qiagen, Vienna, Austria) for at
least 1 h at 4 °C. The lysate ⁄ resin mixture was poured into a
column at room temperature and washed twice with 1 mL
lysis buffer, before further washing twice with 4-mL aliquots
of a lysis buffer containing 20 mm imidazole. Elution was
performed using four 0.5-mL aliquots of a lysis buffer con-
taining 250 mm imidazole. All fractions were collected on ice.
Protein assays were performed using the modified Lowry kit
(Sigma, Vienna, Austria).
Western blotting
Aliquots of the soluble fractions of lysed bacteria or of
affinity chromatography fractions (20 lL) were precipitated

O before NMR
analysis. Spectra were recorded at 300 K at 300.13 MHz
for
1
H, at 75.47 MHz for
13
C, and at 121.49 MHz for
31
P
with a Bruker AVANCE 300 spectrometer equipped with a
5-mm QNP-probehead with z gradients. Data acquisition
and processing were performed with the standard xwinnmr
software (Bruker BioSpin GmbH, Rheinstetten, Germany).
1
H-NMR spectra were referenced to 2,2-dimethyl-2-silapen-
tane-5-sulfonic acid (d ¼ 0),
13
C-NMR spectra were refer-
enced externally to 1,4-dioxane (d ¼ 67.40), and
31
P-NMR
spectra were referenced externally to H
3
PO
4
(d ¼ 0).
HMQC and HMBC spectra were recorded in the phase-
sensitive mode using TPPI and pulsed field gradients for
coherence selection.
Developmental transcript analysis

dra Drozd, a previous project student in the
laboratory, for the initial cloning of the Caenorhabditis
gmd-1 and ger-1 cDNAs, and Dr Andreas Hofinger
for recording the NMR spectra.
References
1 Becker DJ & Lowe JB (2003) Fucose: biosynthesis and
biological function in mammals. Glycobiology 13, 41R–
53R.
2 Haltiwanger RS (2002) Regulation of signal transduc-
tion pathways in development by glycosylation. Curr
Opin Struct Biol 12, 593–598.
3 Shi S & Stanley P (2003) Protein O-fucosyltransferase 1
is an essential component of Notch signaling pathways.
Proc Natl Acad Sci USA 100, 5234–5239.
4 Sasamura T, Sasaki N, Miyashita F, Nakao S, Ishikawa
HO, Ito M, Kitagawa M, Harigaya K, Spana E, Bilder
D, et al. (2003) neurotic, a novel maternal neurogenic
gene, encodes an O-fucosyltransferase that is essential
for Notch–Delta interactions. Development 130, 4785–
4795.
5 Okajima T & Irvine KD (2002) Regulation of notch sig-
naling by O-linked fucose. Cell 111, 893–904.
6 Menzel O, Vellai T, Takacs-Vellai K, Reymond A, Mu-
eller F, Antonarakis SE & Guipponi M (2004) The Cae-
norhabditis elegans ortholog of C21orf80, a potential
new protein O-fucosyltransferase, is required for normal
development. Genomics 84, 320–330.
7 Maly´ P, Thall AD, Petryniak B, Rogers GE, Smith PL,
Marks RM, Kelly RJ, Gersten KM, Cheng GY,
Saunders TL, et al. (1996) The a(1,3)-Fucosyltransferase

biosynthesis in vitro. J Biol Chem 273, 8193–8202.
15 Ohyama C, Smith PL, Angata K, Fukuda MN, Lowe
JB & Fukuda M (1998) Molecular cloning and expres-
sion of GDP-D-mannose-4,6-dehydratase, a key enzyme
for fucose metabolism defective in Lec13 cells. J Biol
Chem 273, 14582–14587.
16 Tonetti M, Sturla L, Bisso A, Benatti U & De Flora A
(1996) Synthesis of GDP-L-fucose by the human FX
protein. J Biol Chem 273, 27274–27279.
17 Bonin CP, Potter I, Vanzin GF & Reiter W-D (1997)
The MUR1 gene of Arabidopsis thaliana encodes an iso-
form of GDP-D-mannose-4,6-dehydratase, catalyzing
the first step in the de novo synthesis of GDP-L-fucose.
Proc Natl Acad Sci USA 271, 2085–2090.
18 Bonin CP, Freshour G, Hahn MG, Vanzin GF & Reiter
W-D (2003) The GMD1 and GMD2 genes of Arabidop-
sis encode isoforms of GDP-D-mannose 4,6-dehydratase
with cell type-specific expression patterns. Plant Physiol
132, 883–892.
19 Bonin CP & Reiter W-D (2000) A bifunctional
epimerase-reductase acts downstream of the MUR1 gene
GDP-fucose biosynthesis in invertebrates S. Rhomberg et al.
2254 FEBS Journal 273 (2006) 2244–2256 ª 2006 The Authors Journal compilation ª 2006 FEBS
product and completes the de novo synthesis of GDP-L-
fucose in Arabidopsis. Plant J 21, 445–454.
20 Andrianopoulos K, Wang L & Reeves PR (1998) Identi-
fication of the fucose synthetase gene in the colanic acid
gene cluster of Escherichia coli K-12. J Bacteriol 180,
998–1001.
21 Ja

Mouse lymphoma cell lines resistant to pea lectin are
defective in fucose metabolism. J Biol Chem 255, 9900–
9906.
27 Smith PL, Myers JT, Rogers CE, Zhou L, Petryniak B,
Becker DJ, Homeister JW & Lowe JB (2002) Condi-
tional control of selectin ligand expression and global
fucosylation events in mice with a targetted mutation at
the FX locus. J Cell Biol 158, 801–815.
28 Coyne MJ, Reinap B, Lee MM & Comstock LE (2005)
Human symbionts use a host-like pathway for surface
fucosylation. Science 307, 1778–1781.
29 Lamrabet Y, Bellogı
´
n RA, Cubo T, Espuny R, Gil A,
Krishnan HB, Megias M, Ollero FJ, Pueppke SG, Ruiz-
Sainz JE, et al. (1999) Mutation in GDP-fucose synthe-
sis genes of Sinorhizobium fredii alters nod factors and
significantly decreases competitiveness to nodulate
soybeans. Mol Plant-Microbe Interact 12, 207–217.
30 Gonzales-Yanes B, Mandell RB, Girard M, Henry S,
Aparicio O, Gritzali M, Brown RD, Erdos GW &
West CM (1989) The spore coat of a fucosylation
mutant in Dicytostelium discoideum. Dev Biol 133,
576–587.
31 Karsan A, Cornejo CJ, Winn RK, Schwartz BR, Way
W, Lannir N, Gershoni-Baruch R, Etzioni A, Ochs HD
& Harlan JM (1998) Leukocyte Adhesion Deficiency
Type II is a generalized defect of de novo GDP-fucose
biosynthesis: endothelial cell fucosylation is not required
for neutrophil rolling on human nonlymphoid endothe-

277, 3168–3175.
37 Nakayama K-i, Maeda Y & Jigami Y (2003) Interaction
of GDP-4-keto-6-deoxymannose-3,5-epimerase-4-reduc-
tase with GDP-mannose-4,6-dehydratase stabilises the
enzyme activity for formation of GDP-fucose from
GDP-mannose. Glycobiology 13, 673–680.
38 Harper AD & Bar-Peled M (2002) Biosynthesis of
UDP-xylose. Cloning and characterization of a novel
Arabidopsis gene family, UXS, encoding soluble and
putative membrane-bound UDP-glucuronic acid decar-
boxylase isoforms. Plant Physiol 130, 2188–2198.
39 Albermann C, Distler J & Piepersberg W (2000) Pre-
parative synthesis of GDP-b-L-fucose by recombinant
enzymes from enterobacterial sources. Glycobiology 10,
875–881.
40 Rentmeister A, Hoh C, Weidner S, Dra
¨
ger G, Elling L,
Liese A & Wandrey C (2004) Kinetic examination and
simulation of GDP-b-L-fucose synthetase reaction using
NADPH or NADH. Biocatalysis and Biotransformation
22, 49–56.
41 Ginsburg V (1960) Formation of guanosine diphosphate
l-fucose from guanosine diphosphate d-mannose. J Biol
Chem 235, 2196–2201.
42 Broschat KO, Chang S & Serif G (1985) Purification
and characterisation of GDP-D-mannose 4,6-dehydra-
tase from porcine thyroid. Eur J Biochem 133, 397–401.
43 Chang S, Duerr B & Serif G (1988) An epimerase-
reductase in l-fucose synthesis. J Biol Chem 263, 1693–

51 Liao T-H & Barber GA (1972) Purification of guanosine
5¢-diphosphate d-mannose oxidoreductase from Phaseo-
lus vulgaris. Biochim Biophys Acta 276, 85–93.
52 Coffey JW, Miller ON & Dellinger OZ (1964) The meta-
bolism of l-fucose in the rat. J Biol Chem 239, 4011–4017.
53 Ishihara H & Heath EC (1968) The metabolism of l-
fucose III. The biosynthesis of guanosine diphosphate
l-fucose in porcine liver. J Biol Chem 243, 1110–1115.
54 Ishihara H, Massaro DJ & Heath EC (1968) The meta-
bolism of 1-fucose IV. The enzymatic synthesis of b-l-
fucose 1-phosphate. J Biol Chem 243, 1103–1109.
55 Miller EN, Rupp AL, Lindberg MK & Wiese TJ (2005)
Tissue distribution of l -fucokinase in rodents. Comp
Biochem Physiol B 140, 513–520.
56 Ma
¨
ki M, Ja
¨
rvinen N, Ra
¨
bina
¨
J, Roos C, Maaheimo H,
Mattila P & Renkonen R (2002) Functional expression
of Pseudomonas aeruginosa GDP-4-keto-6-deoxy-
D-mannose reductase which synthesises GDP-rhamose.
Eur J Biochem 269, 593–601.
57 Mulichak AM, Bonin CP, Reiter W-D & Garavito RM
(2002) Structure of the MUR1 GDP-mannose 4,6-dehy-
dratase from Arabidopsis thaliana: implications for

to thrombospondin type 1 repeats. J Biol Chem 281,
9393–9399.
GDP-fucose biosynthesis in invertebrates S. Rhomberg et al.
2256 FEBS Journal 273 (2006) 2244–2256 ª 2006 The Authors Journal compilation ª 2006 FEBS


Nhờ tải bản gốc
Music ♫

Copyright: Tài liệu đại học © DMCA.com Protection Status