Engineering and use of
32
P-labeled human recombinant interleukin-11
for receptor binding studies
Xiao-Ming Wang
1
, Jean-Marc Wilkin
1
, Olivier Boisteau
2
, Dimitri Harmegnies
1
, Chrystel Blanc
3
,
Paul Vandenbussche
1
,Fe
Â
lix A. Montero-Julian
3
, Yannick Jacques
2
and Jean Content
1
1
Institut Pasteur de Bruxelles, Belgium;
2
Groupe Recherche Cytokines/Re
Â
cepteurs, Unite
lation.
Keywords: interleukin-11; cytokines; phosphorylation;
radiolabeling; re ceptor b inding.
Interleukin-11 (IL-11) i s a pleiotropic cytokine that has been
shown to exhibit multiple effects o n hematopoietic and
nonhematopoietic systems, includin g the liver , gastrointest-
inal tract, lung, heart, central nervous system, bone, joint,
and immune system [1]. IL-11 has hematopoietic and
thrombocytopoietic activities: in vivo IL-11 administration
stimulates megakaryocyte maturation and increases p eriph-
eral plate let counts [2] as well as accelerating recovery f rom
chemotherapy-induced or bone-marrow t ransplantation-
induced thrombocytopenia [2±6]. Numerous experiments
on animal models and clinical trials in patients suffering
from acute and chronic i n¯ammatory d iseases, including
rheumatoid arthritis [7±9], in¯ammatory liver disease [10],
in¯ammatory bowel disease [11±13], mucositis [14], a nd
psoriasis [15], have revealed that IL-11 is a lso an anti-
in¯ammatory and mucosal protective agent. Another
important role of IL-11 played in female fertility h as be en
evidenced by the fact that female mice lacking IL-11
receptor are infertile due to a failure of trophoblast
implantation [16].
IL-11 belongs to the gp130 family of cytokines that
includes interleukin-6 (IL-6), viral I L-6 (vIL-6), ciliary
neurotropic factor (CNTF), leukemia inh ibitory factor
(LIF), oncostatin M (OSM), cardiotrophin-1 (CT-1), and
novel neurotr ophin-1/B cell-stimulating f actor-3 (NNT-1/
BSF-3) [17±20]. These cytokines use the c ommon r eceptor
subunit g p130 for signal transduction by which Janus
Correspondence to J. Content, Institut Pasteur de Bruxelles, rue
Engeland 642, B-1180, Brussels, Belgium. Fax: + 32 2373 32 91,
Tel.: + 32 2373 34 16, E-mail: or X M. Wang,
Fax: + 3 2 2373 32 91, Tel.: + 32 2373 32 28,
E-mail:
Abbreviations: IL, interleukin; IL-11R, interleukin-11 receptor; vIL-6,
viral IL-6; CNTF, c iliary neurotropic factor; LIF, leukem ia inhibitory
factor; OSM, oncostatin M; CT-1, cardiotrophin-1;
NNT-1/BSF-3, novel neurotrophin-1/B cell-stimulating factor-3;
DMEM, Dulbecco's modi®ed Eagle's medium; Jaks, Janus kinase.
(Received 19 July 2001, revised 22 October 2001, accepted 22 October
2001)
Eur. J. Biochem. 269, 61±68 (2002) Ó FEBS 2002
recently proposed by Barton et al . [28]. Which one is the
active signalling receptor c omplex? This question will not be
answered until much more infor mation i s available on the
situation within intact cells.
The effects of IL-11 must be mediated by the IL-11Ra
and the latter provides ligand speci®city in a functional
multimeric signal transduction complex with gp130. Two
isoforms of the human IL-11R a-chain have been identi-
®ed and cloned [29]. They share identical extracellular
and transmembrane do mains but differ in their C-terminus.
One isoform has a cytoplasmic domain, whereas the second
lacks the entire cytoplasmic domain. Both these isoforms
[30] and the soluble I L-11Ra, lacking both the transmem-
brane and cytoplasmic domains [31], were shown to have
similar functional properties, suggesting the dispensability
of these two domains for s ignaling. Structurally, the
extracellular region of the IL-11Ra could be divided into
from Gibco-BRL.
Construction of expression plasmids for recombinant
human IL-11
EcoRI and NotI s ites were ®rst introduced by P CR at two
ends of the hIL-11 gene using two primers G310
(5¢-ATCCGGAATTCCCTGGGCCACCACCTGGCCC
CCCT-3¢) and G311 (5¢-ATAGTTTAGCGGCCGCT
TACAGCCGAGTCTTCAGC-3¢) and pIL-11/1 as tem-
plate plasmid. To generate the Eco RI±NotICPDIL11
fragment, which contains an N-terminal Cys (C) and a
bovine heart kinase phosphorylation site ( P) as well as a
modi®ed IL-11 lacking the ®rst 10 amino acids (DIL11),
another PCR was performed using two oligonucleotides
YIL11TAG (5¢-ATCCGGAATTCGGTTGTGGTCGT
CGTGCATCTGTTGCATCCCCAG-3¢) and YIL11/Not
I(5¢-ATAGTTTAGCGGCCGCTTACAGCCGAGTCTT
CAG-3¢). This fragmentwasinserted in the vector YepFlag-1
(Kodak Scienti®c Imaging S ystem) just next to the Flag tag at
the restriction site EcoRI to generate plasmid YepFlag-
CPDIL11. T he fragment NdeI±No tI(Flag-CPDIL-11) was
obtained b y the third PCR using two primers G353 (5¢-
GGAATTCCATATGGACTACAAGGATGACGATG
ACAAG-3¢) and G354 (5¢-ATAGTTTAGCGGCCGCT
CACAGCCGAGTCTTCAG-3¢) and the above plasmid as
template. The expression plasmid pET-FCPDIL1 1 was
constructed b y insertion in phase of the fragment NdeI±
NotI into the vector pET-22b(+) (N ovagen) at the sites NdeI
and NotI. Because the recombinant protein FCPDIL-11
forms a dimer via the r esidue Cys a nd loses t he binding
activity on cells, another plasmid pET-FPDIL11 was c reat ed
25 min at 4 °C, the supernatant was precipitated with
(NH
4
)
2
SO
4
at a concentration o f 60% s aturation in order to
concentrate crude proteins. Salts were eliminated by dialysis
against 5 0 m
M
Hepes, pH 7.4 buffer b efore the puri®cation
of samples by c hromatography. T wo puri®cation protocols
were used. In the ®rst one, a small amount of pure FPDIL-11
was obtained after puri®cation on a Mono-S HR5/5 column
(Amersham P harmacia Biotech) using a 50 m
M
Hepes
buffer, pH 7.4, and a 0±1
M
NaCl gradient. This pure
protein was used for labeling and binding assays. Another
protocol combining chromatography on an SP-Sepharose
column using a 5 0 m
M
Hepes buffer, pH 7.4, and a 0±1
M
NaCl gradient, and af®nity chromatography on an anti-
Flag Ig column allowed t he puri®cation of larger amounts of
FPDIL-11. We used this preparation to maintain the
H. Verschueren, Pasteur Institute of Brussels, Belgium), and
CESS myelomonocytic leu kaemia cells were maintained in
RPMI-1640 (with glutamine) containing 10% (v/v) fetal
bovine serum. MG-63 osteosarcoma cells, A375 metastatic
melanoma cells, HeLa epithelial carcinoma cells, RD
rhabdomyosarcoma cells, and SK-N-MC neuroblastoma
cells (provided by H. Verschueren) were maintained in
DMEM containing 10% fetal bovine serum and 2 m
M
glutamine. All cell lines were maintained at 37 °Cand5%
CO
2
.
IL-11 bioassay
IL-11 activity was measured using the IL-11-dependent
mouse hybridoma cell line 7 TD1. These cells were cultivated
in ¯at-bottom m icrotiter plate that contained 2 ´ 10
3
cells
per well in the presence of twofold dilutions of IL-11
(2 lgÁmL
)1
). After 7 days of cultu re, the number o f
surviving cells was determined by a c olorimetric assay of
hexosaminidase. I n this assay, the absorbance is propor-
tional to the number of cells present in each culture [35].
Each sample was tested in triplicate.
Labeling of FPDIL-11 with [c-
32
P]ATP
M
sodium
pyrophosphate, and 10 m
M
EDTA, pH 7.0 at 4 °C. The
32
P-labeled FPDIL-11 was dialyzed against 3 L of PPE
overnight at 4 °C and then against 1 L of NaCl/P
i
buffer for
4 h . Incorporation of radioactivity into FPDIL- 11 was
measured with a liquid scintillation spectrometer after
precipitation of the p rotein with 10% trichloroacetic acid.
SDS/PAGE of [
32
P]FPDIL-11 w as performed o n a slab gel
by the method of Laemmli [33]. The purity of [
32
P]FPDIL-
11 was c hecked after drying a nd exposi ng t he gel to an
X-ray ®lm (Kodak XAR) for autoradiography.
Binding of [
32
P]FPDIL-11 to cells
Cells (1 ´ 10
6
) were preincubated i n culture medium lack-
inggrowthfactorfor2handwerewashedthreetimes
with NaCl/P
i
proteins, such as IFN-a and diphtheria toxin, r esulted in a
high speci®c radioactivity after
32
P-labeling and had no
signi®cant effect on their biological activity [37±39], we
therefore decided to adopt a similar strategy f or IL-11. This
strategy is illustrated in Fig. 1. The N-terminal nucleotides
encoding the ®rst 10 amino acids of IL-11 w ere deleted and
replaced by a s equence encoding a F lag tag (Asp-Tyr-Lys-
Asp-Asp-Asp-Asp-Lys) followed by a consensus amino-
acid sequence (Arg-Arg-Ala-Ser-Val-Ala) that can be
recognized and phosphorylated on the serine residue by
the bovine heart kinase [37]. The Flag tag was introduced at
the end of the molecule to facilitate its puri®cation by
af®nity chromatography and immunological detection
[40±42]. The ®rst 10 amino acids of hIL-11 were deleted i n
order to keep the size o f the recombinant FPDIL-11 similar
to that of hIL-11 and to avoid the p roblem of expression
that may arise in E. coli because of the presence of many
consecutive p roline r esidues at the N-terminus. This d eletion
was made possible because the ®rst 13 N-terminal amino
acids a re not necessary for its biological activity and not part
of the s ites, a s identi®ed by molecular modelling and
site-directed mutagenesis, involved in receptor binding
[18,43±45].
Fig. 1. Nucleotide a nd amino acid se quences of the N -terminus of human
IL-11 and FP DIL-11. The Flag tag is boxed. The ®rst 10 amino acids of
hIL-11 are bold. The phosphorylation site recognized by the bovine
heart protein kinase catalytic subunit created in FP DIL-11 is under-
lined.
)1
, con®rming that the
®rst 10 amino acids are dispensable for the biolo gical
activity of IL-11 a nd in dicating that the presence of the Flag
tag as w ell as t he phosphorylation site at the N-terninus
have no detectable effect on the IL-11 functionality.
Labeling of FPDIL-11
FPDIL-11 was labeled with [c-
32
P]ATP using bovine heart
protein kinase. Autoradiography of the labeled ligand
con®rmed the success of the phosphorylation. Speci®c
radioactivity attained about 250 000 cpmÁng
)1
of protein,
which corresponds to a nearly complete radiophosphate
labeling of the IL-11 molecules. Speci®city of the labeling
was demonstrated using both E. coli bacteriophage k
protein phosphatase and wild-type hIL-11. Bacteriophage
k phosphatase can hydrolyze phosphate groups on serine,
threonineor tyrosine-histidine residues.Incubating[
32
P]inter-
leukin with this enzyme resulted i n the complete loss of its
radioactive label (Fig. 4A). Human IL-11, which does n ot
contain any putative phosphorylation site, could not be
radiolabeled under similar conditions (data not shown).
Previous observations have shown that t he appar ent
molecular masses o f phosphorylated and nonphosphory-
lated proteins are slightly different on SDS/PAGE [46].
3
cells per well in the presence of serial dilutions of the
cytokine. After 7 days of culture , the num be r of s urviving cells was
determined by a colorimetric assay of he xo saminidase. I n t his a ssay,
the a bsorbance is proportional t o the number of cells p resent in each
well. Each sample was t ested in triplicate.
64 X M. Wang et al. (Eur. J. Biochem. 269) Ó FEBS 2002
respectively, full length hIL-11Ra and hIL-11R a lacking the
cytoplasmic domain [30]. All binding experiments were
carried out at 4 °C to p revent cell internalization of the
ligand.
No speci®c binding of [
32
P]FPDIL-11 could be detected
on parental Ba/F3 cells. The kinetics of the association of
radiolabeled FP DIL-11 with B13Ra1 cells revealed that the
radioligand r eached its maximum association to cells after
1-h i ncubation at 4 °C. In subsequent equilibrium binding
studies, [
32
P]FPDIL-11 was therefore i ncubated with cells
for 90 min.
The dose±response curve of [
32
P]FPDIL-11 binding to
B13Ra1 cells is shown in Fig. 5. Nonspeci®c binding
component, determined b y adding a 200-fo ld molar excess
of unlabeled FPDIL-11, was low (less than 5 % of the total
association). A nalysis of t he speci®c binding data by the
method of Scatchard indicated the existence of a single class
Scatchard analysis (Fig. 6). I L-6 was used as a negative
control a s this cytokine and IL-11 do not compete for the
same receptors [47]. When wild-type hIL-11 and
[
31
P]FPDIL-11 were used as competitors, similar results
were obtained, suggesting that addition of the Flag t ag and
phosphorylation site, and phosphorylation of this site at the
serine residue as well as deletion of the ®rst 10 amino a cids,
have no effect on IL-11 binding to the human IL-11Ra and
gp130 receptor complex.
When 7TD1 cells were used for r eceptor binding assay,
Scatchard a nalysis o f the data revealed that these cells have
% 550 r eceptors pe r cell with a K
d
around 0.97 n
M
.Human
IL-11Ra can i nteract with murine gp130 and this provides a
speci®c high-af®nity binding site for hIL-11 [49]. The
binding of [
32
P]FPDIL-11±7TD1 cells expressing both
murine IL-11R a and murine gp130 demonstrated that the
interaction between hIL-11 and murine IL-11Ra and
murine gp130 was also of h igh a f®nity. Taken t ogether,
these observations suggest that human and murine IL-11
Fig. 5. Binding o f radiolabeled ligand to B13Ra1cells.The b in ding of
[
32
homolog [29,36]. Although both cytokines display relatively
poor homology i n the D1 domain, domains D2 and D3 a re
well conserved. The Ig-like domain (D1) i s n ot required for
ligand b inding as the presence of IL-11 and IL-11R-D2,3 is
suf®cient to induce b iological activity [50]. The residues
responsible for the ligand binding are mainly located in the
D3, and D2 plays only a minor role [32].
Several human hematopoietic and nonhematopoietic
cell lines (THP-1 monocytic leukaemia cells, K562 chronic
myelogenous leukaemia cells, CESS myelomonocytic
leukaemia cells, MG-63 osteosarcoma cells, A375 meta-
static melanoma cells, He La e pithelial carcinoma cells,
RD r habdomyosarcoma cells, and SK-N-MC n euroblas-
toma cells) h ave been tested using [
32
P]FPDIL-11 to
obtain information about the expression of human IL-11
receptors. S peci®c binding was observed in THP-1 and
MG-63 cells and Scatchard plot analysis revealed that
they have, % 600 a nd 800 receptors, r espectively, per cell
(data not shown). This is t he ®rst time that cell surface
expression of human IL-11 receptors is shown directly in
human cells by use of a radioligand. We found the
presence of IL-11Ra on THP-1 cells. This is consistent
with previous observations that IL-11 is involved in the
regulation of production of pro-in¯ammatory cytokines
such as TNF-a,IL-1b,IFN-c and I L-12 by monocytes
[55,56], and that the IL-11 receptor analysis on human cell
lines by ¯ow cytometry using monoclonal anti-IL-11Ra Ig
has also r evealed t he expression of IL-11Ra on these cells
IC
50
of 0.34 n
M
for H 2 and 0.58 n
M
for H 56 (Fig. 6 A). It
should be noted that H2 and H56 are not competitive
inhibitors of cytokine binding but rather interfere w ith the
formation of the IL-11±IL-11R±gp130 complex. The IC
50
values of both antibodies that inhibit I L-11-induced
proliferation of B13Ra1 cells (3 n
M
for H2 and 5 n
M
for
H56) were 10-fold higher than the antibodies concentrations
that inhibit [
32
P]FPDIL-11-receptor b inding on the s ame
cells (0.34 n
M
for H2 and 0.58 n
M
for H56). T hese results a re
nevertheless not contradictory because IC
50
values a re not
intrinsic constants a s t hey d epend o n th e concentration o f
was calculated to be about 0.252 n
M
for rhIL-11, 0.377 n
M
for FPDIL-11, and 0.337 n
M
for
[
31
P]FPDIL-11. These v alues were o btained by the me thod of Ch eng & Pruso [59]. I C
50
wascalculatedtobe% 0.3 4 n
M
for H2, 0.5 8 n
M
for H56,
0.20 n
M
for MAB628, a nd 0.47 n
M
for B-R3.
66 X M. Wang et al. (Eur. J. Biochem. 269) Ó FEBS 2002
agreement w ith t he proliferation data, none of them had any
inhibitory effect on FPDIL-11 binding (data not shown), thus
reinforcing t he conclusion that the e pitopes recognized by all
these antibodies are distinct from t he ligand binding site.
The i ntroduction of a phosphorylation site into IL-11 and
other proteins p rovides a convenient and simple m ethod to
label the proteins to high speci®c radioactivities. If multiple
phosphorylation sites wer e introduced into proteins, much
suppressive regimen of sublethal irradiation and carboplatin.
Blood 83 , 1499±1506.
4. Schlerman, F.J., Bree, A.G., K aviani, M., N agle, S.L., Donnelly,
L.H., Mason, L.E., S ch aub, R.G., Grupp, S.A. & Go ldman, S.J.
(1996) Thrombopoieti c activity of recombinant human interleukin
11 (rHuIL-11) in normal and myelosuppressed nonhuman
primates. S tem Cells. 14, 517±532.
5.Tepler,I.,Elias,L.,Smith,J.W.,nd,Hussein,M.,Rosen,G.,
Chang,A.Y.,Moore,J.O.,Gordon,M.S.,Kuca,B.,Beach,K.J.,
Loewy, J.W., Garnick, M.B. & Kaye, J .A. (1996) A randomized
placebo-controlled trial of recombinant human interleukin -11 in
cancer patients with severe th romb ocytopenia due to chemother-
apy. Blood 87, 3607±3614.
6. Isaacs, C., Robert, N.J., Baile y, F.A., Schuster, M.W., O ver-
moyer,B.,Graham,M.,Cai,B.,Beach,K.J.,Loewy,J.W.&
Kaye, J.A. (1997) Randomized placebo-controlled study of
recombinant human interleukin-11 to prevent chemotherapy-
induced thrombocytopenia in patients w ith breast cancer r eceivin g
dose-intensive cyclophosphamide and doxorubicin. J. Clin. Oncol.
15, 336 8±3377.
7. Anguita, J., Barthold, S.W., Samanta, S ., Ryan, J. & Fikrig, E.
(1999) Selective anti-in¯ammatory action of interleukin-11 in
murine Lyme disease: arthritis decreases while carditis persists.
J. Infect. Dis. 179, 734±737.
8. Walmsley, M., Butler , D .M., Marinova-Mutafchieva, L. &
Feldmann, M. (1998) An anti-in¯ammatory role for interleukin-11
in established murine collagen-induced a rthritis. Imm unolo gy 95 ,
31±37.
9. Trontzas, P ., Kamper , E.F., Potamianou, A., Kyriazis, N .C.,
Kritikos, H. & Stav ridis, J. (1998) Comparative s tudy of serum
for interleukin 11 is due to a defective uterine resp onse to
implantation. Nat. M ed. 4, 303±308.
17. Kalai, M., Montero-Julian, F.A., Gro
È
tzinger, J., Fontaine, V.,
Vandenbussche, P., Deschuyteneer, R., Wollmer, A., Brailly, H. &
Content, J. (1997) A nalysis of t he IL-6/IL-6R bi nding i nterface at
the amino acid level: proposed mechanisms of interaction. Blood
89, 1319 ±1333.
18. Jacques, Y ., Minvielle, S., Mul ler-Newen, G., Heinrich, P.C.,
Gro
È
tzinger, J., M ontero-Julian, F.A., Brailly, H ., Wilkin, J.M. &
Content, J. (1998) T he interleukin-11/receptor complex: rational
design of agonists/antagonists and immunoassays potentially
useful in h uman therapy. Res. Immunol. 149, 737±740.
19. Senaldi, G ., Varnum, B.C., Sarmiento, U., Starnes, C ., Lile, J.,
Scully, S., Guo, J., Elliott, G., Mcninch, J., Shaklee, C.L., Free-
man,D.,Manu,F.,Simonet,W.S.,Boone,T.&Chang,M.S.(1999)
Novel neurotrophin-1/B cell-stimulating factor-3: a cytokine of the
IL-6 family. Proc. Natl A cad. Sci. USA 96, 11458±11463.
20. Neipel, F., Albrecht, J.C., Ensser, A., Huang, Y.Q., Li, J.J.,
Friedmanklein, A.E. & Fleckenstein, B. (1997) Human herpes-
virus 8 encodes a homolog of interleukin-6. J. Vir o l. 71, 839±842.
21. Heinrich, P.C., Behrman n, I., Mul ler-Newen , G., Sch aper, F. &
Graeve, L. (1998) Interleukin-6-type cytokine signalling through
the gp130/Jak/STAT pathway. Biochem. J. 334 , 297±314.
22. Taga, T. & Kishimoto, T. (1997) gp130 and the interleukin-6
family of c ytokines. Annu. Rev . Immunol. 15 , 797±819.
23. Wan, X .Y., Wang, H.L. & Nicholas, J. (1999) Human herpesvirus
Dahmen, H., Cherel, M., Heinrich, P.C., Brailly, H., Hallet, M.M.,
Godard, A., Minvielle, S. & Jacques, Y. (1997) Reconstitution
of two isoforms of the human interleukin-11 receptor and com-
parison of t heir functional properties. FEBS Lett. 407, 141±147.
31.Karow,J.,Hudson,K.R.,Hall,M.A.,Vernallis,A.B.,Taylor,
J.A., G ossler, A. & Heath, J.K. (1996) Media tion of interleukin -
11-dependent biological responses b y a soluble f orm of t h e inter-
leukin-11 r eceptor. Biochem. J. 318, 489 ±495.
32. Schleinkofer, K., D ingley, A., T acke n, I., F ederwisc h, M., M uller-
Newen, G., H einrich, P.C., V usio, P., Jacques, Y. & Gro
È
tzinger, J.
(2001) Identi®cation of t he domain in the human interleukin-11
receptor that mediates ligand binding. J. Mol. Biol. 306, 263±274.
33. Laemmli, U.K. (1970) Cleavage of structural p roteins during the
assembly of the head of bacteriophage T4. Nature 227, 6 80±685.
34. Fontaine, V., Savino, R., Arcone, R., De Wit , L., Brakenho, J.P.,
Content, J. & Ciliberto, G. ( 1993) Involvement of the Arg179 in
theactivesiteofhumanIL-6.Eur. J. Biochem. 211, 749±755.
35. Van Snick, J., Cayphas, S., Vink, A., Uyttenhove, C., Coulie,
P.G., Rubira, M .R. & Simpson, R.J. (1986) Puri®cation a nd NH
2
-
terminal amino acid sequence of a T -cell- derived lymphokine with
growth factor activity for B -cell hybridomas. Proc . Natl Acad. Sci.
USA 83, 9679±9683.
36. Hilton, D.J., Hilton, A.A., Raicevic, A., Rakar, S., Harrison-
Smith, M., Gough, N.M., Begley, C.G., Metcalf, D., Nicola, N.A.
& Willson, T .A. (1994) Cloning of a murine IL-11 receptor a lpha-
chain; re qu irement for gp130 for high anity bin ding and signal
of receptor bin ding sites on human interleukin-11 by mole cular
modeling-guided mutagenesis. Eur. J. Biochem. 265, 645±655.
45. Barton, V.A., H udson, K.R. & Heath, J.K. (1999) Ide nti®cation
of three distinct receptor binding site s of m urine interleukin-11.
J. Biol. Chem. 274, 5 755±5761.
46. Schaper, F., Gen do, C., E ck, M., Schmitz, J., G rimm, C.,
Anhuf, D., K err, I.M. & Heinrich, P.C. (1998) Activation of the
protein tyrosine phosphatase SHP2 via the interleukin-6 signal
transducing receptor protein gp130 requires tyrosine kinase Jak1
and limits acute-phase proteine xpression. Biochem. J. 335, 557±565.
47. Yang, Y .C. & Yin, T.G. (1992) Interleukin-11 and its receptor.
Biofactors 4, 15±21.
48. Yin, T.G., Miyazawa, K. & Y ang, Y.C. (1992) Characterization of
interleukin-11 receptor and protein tyrosine phosphorylation
induced by interleuk in-11 in mouse 3T3-L1 cells. J. Biol. Chem.
267, 8347±8351.
49. Nandurkar, H.H., H ilton, D.J., Nathan, P., Willson, T., Nicola,
N. & Begley, C.G. (1996) The human IL-11 receptor requires
gp130 for signalling: demonstration by molecular cloning of the
receptor. Oncogene 12 , 585±593.
50. P¯anz, S., Tacken, I., G rotzinger, J., J acques, Y., Minvielle, S.,
Dahmen, H., Heinrich, P .C. & Muller-Newen, G . ( 1999) A fusion
protein of in terleukin-11 a nd soluble interleukin-11 receptor acts as
a superagonist on cells expressing gp130. FEBS Lett. 450, 117±122.
51. Wijdenes, J., Heinrich, P .C.M., Mu
È
ller-Newen, G., Roche, C., Gu,
Z.J., Clement, C . & Klein, B. (1995) Interleukin-6 signal t rans-
ducer gp130 has speci®c binding sites for dierent c ytokines as
determined by a ntagonistic and agonistic anti-gp130 monoclonal
59. Cheng, Y. & Pruso, W.H. (1973) R elationship b etween the
inhibition constant (K1) and the concentration of inhibitor which
causes 5 0 per c ent inhibition ( I50) of an e nzym atic reaction.
Biochem. Pha rmacol. 22, 3099±3108.
68 X M. Wang et al. (Eur. J. Biochem. 269) Ó FEBS 2002