Molecular characterization of Arabidopsis thaliana PUF
proteins – binding specificity and target candidates
Carlos W. Francischini and Ronaldo B. Quaggio
Departamento de Bioquı
´
mica, Instituto de Quı
´
mica, Universidade de Sa˜o Paulo, Brazil
Introduction
The translational control of RNA is an important reg-
ulatory process in animal development. This regulation
is accomplished by sequence-specific RNA-binding
proteins that recognize cis-acting elements usually
located in the 3¢ UTR. In recent years, and as a result
of great efforts aiming to understand the mechanism
of RNA control in animals, the function of a diverse
number of RNA-binding proteins has been elucidated
[1–4]. Despite this, translational control through the
binding of RNA-binding proteins to 3¢ UTR tran-
scripts has been poorly described in plants.
PUF proteins are a large family of RNA-binding
proteins found in all eukaryotes. These proteins reduce
the expression of mRNA targets by binding in 3¢ UTR
regulatory elements, thus controlling translation or
mRNA stability [5]. Members of the PUF family have
been implicated in diverse processes in development. In
Drosophila, Pumilio binds to the Nanos response ele-
ment (NRE) sequence within the 3¢ UTR of maternal
hunchback mRNA and reduces its expression in the
posterior pole of the embryo. This control is essential
for abdomen formation [6]. In Caenorhabditis elegans
APUM-1 to APUM-6 can bind specifically to the Nanos response element
sequence recognized by Drosophila Pumilio. Using an Arabidopsis RNA
library in a three-hybrid screening, we were able to identify an APUM-
binding consensus sequence. Computational analysis allowed us to identify
the APUM-binding element within the 3¢ UTR in many Arabidopsis tran-
scripts, even in important mRNAs related to shoot stem cell maintenance.
We demonstrate that APUM-1 to APUM-6 are able to bind specifically to
APUM-binding elements in the 3¢ UTR of WUSCHEL , CLAVATA-1,
PINHEAD ⁄ ZWILLE and FASCIATA-2 transcripts. The results obtained
in the present study indicate that the APUM proteins may act as regulators
in Arabidopsis through an evolutionarily conserved mechanism, which may
open up a new approach for investigating mRNA regulation in plants.
Abbreviations
APBE, APUM-binding element; APUM, Arabidopsis Pumilio; IRP, iron regulatory protein; NRE, Nanos response element.
5456 FEBS Journal 276 (2009) 5456–5470 ª 2009 The Authors Journal compilation ª 2009 FEBS
development of fruiting bodies [8], whereas, in yeast,
both Puf3 and Puf5 (Mpt5) proteins promote the
decay of COX17 and HO mRNA, respectively,
through binding to their 3¢ UTR sequences [9,10].
Although members of this family of proteins have
been shown to play distinct roles in different organ-
isms, the maintenance and self-renewal of stem cells
appears to be an ancestral function [5,11]. Drosophila
Pumilio binds to a NRE-like sequence within the
3¢ UTR of cyclin B1, repressing its translation and
promoting germline stem cell development [12–14].
C. elegans FBF also controls germline stem cell main-
tenance by regulating gld-1 mRNA expression and sus-
taining mitosis [15]. The Planaria PUF homolog
DJPum is expressed in neoblasts, which are capable of
1-3
AU(A ⁄ U) sequence [7–10,15,22–29]. In
addition to its ability to bind RNA, the PUF
domain was demonstrated to take part in the pro-
tein–protein contacts necessary for RNA regulation
[6,30,31].
In the present study, we report the first analysis of
plant proteins possessing PUF repeats. Using compu-
tational analyses and yeast three-hybrid assays, we
found that at least six Arabidopsis thaliana proteins
possess eight PUF repeats and can specifically recog-
nize the NRE sequence of Drosophila hunchback
mRNA. Through a yeast three-hybrid screening using
an Arabidopsis RNA hybrid library, we identified
mRNAs that may be target candidates of Arabidopsis
Pumilio (APUM) regulation. The screen also allowed
us to determine a consensus sequence recognized by
the six APUM proteins that can bind to the NRE
sequence (APUM-1 to APUM-6). Using this consen-
sus, we show that APUM proteins are able to bind to
the 3¢ UTR of transcripts related to self-renewal and
stem cell maintenance in the shoot apical meristem.
Moreover, the consensus sequence suggests that a great
number of Arabidopsis transcripts are potential targets
for regulation by the PUF family of proteins. The
results obtained reveal a molecular conservation of
PUF proteins in Arabidopsis thaliana and suggest that
translational regulation via binding to 3¢ UTR in
plants may have a role as important as that previously
described in animals.
C. W. Francischini and R. B. Quaggio PUF proteins in Arabidopsis
FEBS Journal 276 (2009) 5456–5470 ª 2009 The Authors Journal compilation ª 2009 FEBS 5457
repeats in the C-terminal region (Fig. 1B), equivalent
to the number found in the well-characterized PUF
proteins [5,11]. Proteins from group III, group IV
and the three outsiders show more similarity among
themselves than they do with the Drosophila PUF
domain (data not shown).
A
B
Fig. 1. Analysis of the 25 putative APUM
proteins. (A) Phylogenetic tree constructed
based on
CLUSTAL W alignment of all putative
APUM proteins and Drosophila Pumilio
(accession number A46221). Numbers rep-
resent the bootstrap analysis from 1000
trials. (B) Number of PUF repeats identified
for each APUM in the
PFAM analysis. Gray
circles represent the localization of repeats
in the protein and the numbers indicate the
position of each repeat in the PUF domain.
Black circles represent repeats identified in
the
PFAM that fall outside the C-terminal
region. APUM proteins were named
APUM-1 to APUM-25.
PUF proteins in Arabidopsis C. W. Francischini and R. B. Quaggio
5458 FEBS Journal 276 (2009) 5456–5470 ª 2009 The Authors Journal compilation ª 2009 FEBS
Table 1. Amino acid identity between some putative Arabidopsis
PUF proteins in the full-length and PUF domain.
Gene ID Similar to:
Full protein
identity (%)
PUF domain
identity (%)
At2g29190 At2g29140 ⁄ At2g29200 90 95
At3g20250 A4g25880 38 63
At1g78160 At1g22240 65 84
At1g35730 At1g35750 78 80
At5g43090 At5g43110 64 68
A
B
Fig. 2. CLUSTAL W alignment of the APUM proteins with the PUF domains most similar to Drosophila PUF domain. (A) APUM proteins of
group I. (B) APUM proteins of group II.
C. W. Francischini and R. B. Quaggio PUF proteins in Arabidopsis
FEBS Journal 276 (2009) 5456–5470 ª 2009 The Authors Journal compilation ª 2009 FEBS 5459
Binding of APUM to NRE
To test the predictions regarding the RNA-binding
specificities of the putative APUM proteins, we investi-
gated the capacity of APUM to bind to the NRE
sequence of hunchback mRNA (Fig. 3B) [36]. We used
the APUM-2 protein as a representative member of
group I proteins and APUM-7 as a representative of
group II APUM proteins (Table 3).
Protein–RNA interactions was evaluated using yeast
three-hybrid system, which was shown to be a reliable
approach for identifying true interactions [25,33,37–39].
This system uses LexA ⁄ MS2 coat protein fusion to
)
B
)
), were used as baits in the yeast three-hybrid
assay (Fig. 3B) [33]. The results of reporter activation
indicated that APUM-2 interacts with NRE(A
)
B
+
),
Table 2. The 12 Arabidopsis PUF domains most similar to the Dro-
sophila PUF domain.
Gene ID
Similarity to
Drosophila PUF
domain (%)
Identity to
Drosophila PUF
domain (%)
Group I At2g29200 (APUM-1) 74 54
At2g29190 (APUM-2) 75 54
At2g29140 (APUM-3) 74 54
At3g10360 (APUM-4) 73 54
At3g20250 (APUM-5) 73 55
At4g25880 (APUM-6) 69 52
Group II At1g78160 (APUM-7) 56 29
At1g2240 (APUM-8) 55 30
At1g35730 (APUM-9) 51 29
At1g35750 (APUM-10) 53 29
At4g08840 (APUM-11) 57 29
the interaction with NRE(A
+
B
)
) and NRE(A
)
B
)
) was
fully abolished (Fig. 3D). Furthermore, assays using
APUM-7 as prey did not interact with the wild-type or
any of the mutant NREs (Fig. 3C).
To confirm that the result of binding specificity
observed between APUM-2 and NRE can be extended
to the remaining group I proteins, we tested the interac-
tion of APUM-1, APUM-3, APUM-4, APUM-5 and
APUM-6 with wild-type and mutant NREs. Qualitative
(data not shown) and quantitative analysis of LacZ
activity (Fig. 3D) revealed that all five APUMs tested
recognized the NRE and NRE(A
)
B
+
) sequences, but
did not bind to NRE(A
+
B
)
) or NRE(A
)
Asp may restore APUM-7 binding to NRE. In a simi-
lar manner, if this Asp is critical for interaction, its
substitution for a His would be expected to abolish
binding of APUM-2 to NRE.
To evaluate these hypotheses, we tested the interaction
of APUM-2 ⁄ N fi H (APUM-2 with the Asp fi His
A
B
C
D
E
Fig. 3. Interaction analysis between APUM and the NRE transcript.
(A) Schematic representation of the yeast three-hybrid system. (B)
Sequence of the wild-type NRE transcript (WT) and NRE mutants
with nucleotides substitutions in Box A, NRE(A
)
B
+
); Box B,
NRE(A
+
B
)
); and in both Box A and B, NRE(A
–
B
–
). (C) Qualitative
analysis of LacZ reporter activation in the interaction of APUM-2
and APUM-7 with NRE WT and NRE mutants. The iron responsive
ing mRNAs that bind directly to a specific RNA-bind-
ing protein [41–43]. Accordingly, we generated an
Arabidopsis RNA hybrid library of small fragments
(50–150 bp) and used this as prey in a three-hybrid
screen with APUM-2 as bait (Fig. 4A).
From approximately eight million independent Ara-
bidopsis RNA sequences screened, 189 positive interac-
tions derived from 63 distinct sequences were isolated
(Fig. 4B). Of these 63 clones, 27 (43%) were insert
cloned in antisense position. The other 36 clones
(57%) were sense sequences, with five (14%) 3¢ UTR
transcripts (Fig. 4C and Table 4).
Computational analysis of RNA sequences
identified in the yeast three-hybrid screen
Although only five of 63 transcripts identified by the
three-hybrid screens were derived from 3¢ UTR
regions, all of them (sense and antisense) bound to bait
specifically, suggesting the existence of a consensus
motif within these 63 distinct transcripts recognized by
APUM-2. We therefore analyzed these sequences using
multiple expectation maximization for motif elicitation
(meme) as a motif discovery tool [44] (http://meme.
nbcr.net/meme/intro.html). The analysis identified an
eight nucleotide motif present in all 63 transcripts
(Fig. 5A). The consensus possesses a UGUR tetranu-
cleotide sequence, which has been reported to be pres-
ent in all targets of the PUF family [5,11]. In addition,
a(A⁄ U)(U ⁄ G)(A ⁄ U ⁄ C) sequence located one nucleo-
tide downstream of the UGUR motif is highly similar
to the trinucleotide AUA and AUU present in the
As a result of the high occurrence of the APUM
binding sites in the plant genome, we decided to focus
in the binding of APUM consensus to 3¢ UTR tran-
scripts expressed in the tissue related to plant meris-
tems because the regulation of transcripts related to
stem cell maintenance is considered to be an ancestral
function of PUF proteins in animals. Thus, a 32 nucle-
otide region of the 3¢ UTR of CLAVATA-1(CLV-1)
(At1g75820), ZWILLE ⁄ PINHEAD (ZLL) (At5g43810),
WUSCHEL (WUS) (At2g17950) and FASCIATA-2
(FAS-2) (At5g64630) transcripts was cloned in the
pRH5¢ vector and tested with APUM-2 protein in the
three-hybrid system (Fig. 5C). These four transcripts
have been described to code for proteins involved in
diverse developmental processes, including shoot meri-
stem organization, stem cell maintenance and mainte-
nance of cellular organization of apical meristems [46–
50]. The LacZ reporter was activated in all assays
tested (Fig. 5D), indicating that the APBE motif is
sufficient for APUM-2 recognition. The APUM-1,
APUM-3, APUM-4, APUM-5 and APUM-6 proteins
also interacted with these transcripts, whereas APUM-
7 did not (data not shown). These results confirm that
the APBEs can be recognized by proteins of group I
and also indicate that these consensus can be useful to
identify putative mRNAs targeted by APUM-1 to
APUM-6.
Group I APUM proteins requires nucleotides in
both 5¢ and 3¢ of the APBE motif
In the computational analysis used to identify a con-
APUM-2 (Fig. 6B). The interaction of APUM-1,
APUM-3, APUM-4, APUM-5 and APUM-6 proteins
with the FAS-2 transcript was also abolished when
the nucleotides at positions )1 ⁄ )2 were substituted
(Fig. 6D).
These results demonstrate that nucleotides upstream
and downstream of the binding consensus are critical
for interaction with APUMs from group I. We can
therefore consider the APBE as the core binding
element, whereas other flanking nucleotides contribute
to the accomplishment of strong or weak inter-
actions.
Table 4. 3¢ UTR transcripts identified in the yeast three-hybrid screening. Upper case letters and boxed sequences indicate the presumptive
APUM binding sites. Information about each gene product was obtained from the TAIR database.
Gene ID (number of
times isolated) Coding for: Sequence identified (5¢-to3¢)
At3g63500 (7) Protein containing PHD domain;
unknown function
ugcgucugaca
UGUACAGCcccugccaaauuuuaauaggcaat
AGUAAAUAaauaacgacaagaagcaaaugg
At5g24490 (1) Ribosomal protein; unknown function cucaucucuccuuacaguuuaccuguguaggaguuaggguucuuga
auaaacaaugcaacaaagauuguagaagucag
UGUACAUA
At4g36040 (1) Protein containing DNAJ domain;
unknown function
cuacgucggacggaacugggaaaccgaucaguguugguagugaguuaa
cucggugaccgaguuaguagaacgaguuaauuag
UGUAAAUAcgaagcca
At4g39090 (1) ‘Embryo defective’ (RD19); response to
in the mitotic region [29]. Also in C. elegans, the lack
of PUF-8, which is more similar to Drosophila Pumilio
than to FBF, causes germ line dedifferentiation and
the formation of fast growing tumors [52]. In Drosoph-
ila, the single Pumilio has been related to many inde-
pendent processes [14,53–56], and five of the six yeast
PUF homologs, which are significantly divergent in
sequence, appear to have predominately distinct func-
tions [23].
In A. thaliana, we have identified three highly con-
served gene families that account for 22 of 25 putative
PUF proteins. The three remaining proteins can be
divided into a closely-related pair and a single outsider
(Fig. 1A). The large number of copies of highly similar
proteins (Table 1) could be an indicative of redundant
functions in the plant. However, these functions might
be specific to each group of duplicated genes. We
A
B
C
D
E
Fig. 5. Identification and evaluation of a common sequence motif
in the mRNA obtained from yeast three-hybrid screen. (A) Eight
nucleotide motif found by
MEME analysis in all 63 distinct clones.
(B) Deduced APBE. (C) Computational identification of an APBE
(boxed sequences) in the 3¢ UTR region of transcripts FASCIATA-2
(FAS-2), WUSCHEL (WUS), CLAVATA-1 (CLV-1) and ZWILLE ⁄ PIN-
HEAD (ZLL). The sequences shown are the 3¢ UTR regions used in
ficity in human Pumilio-1 (Table 3) and can bind to
the NRE sequence specifically (Fig. 3). Six group II
APUM proteins (APUM-7 to APUM-12) (Fig. 1B)
also possess eight PUF repeats, some of which do not
show conservation in residues directly involved in
nucleotide recognition (Table 3). Through site-directed
mutagenesis and interactions assays, we showed that
this substitution is not responsible for the APUM-7
binding impairment (Fig. 3E).
Although PUF proteins have been shown to recog-
nize RNA through a UGUR tetranucleotide followed
by an AU(A ⁄ U) sequence, the number of nucleotides
between these two sequences is variable among different
homologs. For example, C. elegans FBF recognize
RNA that have the UGUR and AUA sequence sepa-
rated by two nucleotides, whereas C. elegans PUF-8,
Drosophila and human Pumilio and yeast Puf3 recog-
AB
CD
Fig. 6. Analysis of binding affinity between APUM-2 and the FAS-2 3¢ UTR transcripts with nucleotide substitutions upstream and down-
stream of the APBE. (A) Double substitutions in flanking nucleotides of APBE (lower case). Bold letters in the wild-type sequence indicate
the APBE. The first nucleotide of the motif is numbered base one. The individual adenine to guanine substitution at nucleotide four was per-
formed to confirm the deduced APBE, which admits a guanine in this position (Fig. 5). (B) Quantitative analysis of LacZ reporter activation in
the interactions between APUM-2 and the FAS-2 transcripts with substitutions in nucleotides upstream of the APBE. (C) Quantitative analy-
sis of LacZ reporter activation in the interactions between APUM-2 and the FAS-2 transcripts with substitutions in the nucleotides down-
stream of the APBE. (D) Quantitative analysis of LacZ activation in the interactions of APUM-1, APUM-3, APUM-4, APUM-5 and APUM-6
with the FAS-2 transcript wild-type (WT) and FAS-2 transcript with substitutions at positions )2 ⁄ )1.
C. W. Francischini and R. B. Quaggio PUF proteins in Arabidopsis
FEBS Journal 276 (2009) 5456–5470 ª 2009 The Authors Journal compilation ª 2009 FEBS 5465
nize the same two sequences separated by only one
Systematic identification of the mRNA targets for
five of six yeast PUF proteins showed that each homo-
log interacts with specific subpopulations of mRNA.
Moreover, Puf3, Puf4 and Puf5 were shown to bind,
respectively, to 56%, 26% and 49% of all known and
putative 3¢ UTR sequences possessing the binding con-
sensus identified [23]. The same strategy was used to
identify mRNA bound to Drosophila Pumilio in
embryos and adult ovaries. The results obtained were
similar to that for yeast because Pumilio was shown to
interact with approximately 24% of all 3¢ UTR
possessing the motif UGUAHAUA identified in that
study [27].
In the present study, we identified two APUM con-
sensus sequences, named APBEs (Fig. 5A,B), which
are recognized by six APUM proteins. Together, these
two consensus sequences occur in approximately 43%
of all Arabidopsis 3¢ UTR annotated in the Arabidopsis
database (Table 5). The results obtained demonstrate
that transcripts possessing the consensus motif are
strong candidates for in vivo regulation because all
four 3¢ UTR transcripts chosen by bioinformatics anal-
ysis interacted with APUM-1, APUM-2, APUM-3,
APUM-4, APUM-5 and APUM- 6 in the three-hybrid
system assays (Fig. 5C,D; data not shown).
The large numbers of PUF homologs and 3¢ UTR
transcripts with APBE in A. thaliana indicate that
APUM proteins should regulate a large number of
mRNAs in the plant. However, the number of tran-
scripts regulated in vivo could be limited by nucleotides
In the present study, we described a physical interac-
tion between group I APUM proteins and the meriste-
matic transcripts CLV-1, WUS, ZLL and FAS-2
(Fig. 5C,D). Because we have obtained experimental
evidence indicating that some APUM proteins are
localized in to shoot and root meristems, these four
transcripts comprise potentials targets candidates for
APUM regulation. Interestingly, preliminary molecular
assays with APUM antisense plants have confirmed a
potential biological relationship between APUM
proteins and at least two of the four transcripts.
PUF proteins in Arabidopsis C. W. Francischini and R. B. Quaggio
5466 FEBS Journal 276 (2009) 5456–5470 ª 2009 The Authors Journal compilation ª 2009 FEBS
The results obtained in the present study therefore
open up a new area of investigation, suggesting that
many different aspects of the plant can be coordi-
nately regulated by Arabidopsis PUF homologs,
in the same way as that shown for PUF proteins in
animals.
Experimental procedures
Materials
All restrictions enzymes and polymerases were obtained
from Invitrogen (Sa
˜
o Paulo, SP, Brazil). The RNA–protein
interaction Hybrid Hunter kit was obtained from Invitro-
gen (Sa
˜
o Paulo, SP, Brazil). All oligonucleotides were
obtained from Invitrogen (Sa
APUM-5, APUM-6 and APUM-7 into the pYESTrp3
vector (Invitrogen) through recombination in the Gateway
system (Invitrogen). To clone the 3¢ UTR transcripts, two
complementary oligonucleotides corresponding to the
NRE wild-type [36], NRE mutants [33], FAS-2 wild-type
and CLV-1 were synthesized and annealed. Each annealed
pair of oligonucleotides possess a 32 bp sequence of a
3¢ UTR region of transcripts containing the APBE, a 5¢
AvrII or XbaI site and a 3¢ SmaI. After digestion, the
inserts were ligated to an AvrII-SmaI-digested pRH5¢ vec-
tor (Invitrogen). To clone the FAS-2 mutants, WUS,
CLV-1 and ZLL sequences, only sense primers were
synthesized. Each primer was annealed with an antisense
oligonucleotide 5¢-TCCCCCGGGGG-3¢ and extended with
Klenow fragment of Escherichia coli DNA polymerase.
After extension, the double-stranded DNA were digested
with XbaI and SmaI and ligated to an AvrII-SmaI-digested
pRH5¢ vector. The sequences of primers used are given in
Tables S1 and S2.
Single amino acid change in APUM-2 and
APUM-7 proteins
The amino acid substitution to generate pYESTrp3APUM-
2 ⁄ N fi H and pYESTrp3APUM-7 ⁄ H fi N proteins was
obtained according to the protocol described in the Quik-
Change Site-Directed Mutagenesis Kit (Strategene). The
primers used were: 5¢-GAGCCAACAGAAGTTTGCT
TCACACGTTGTTGAGAAATGTTT-3¢ (forward) and
5¢-GTCAAACATTTCTCAACAACGTGTGAAGCAAAC
TTCTGTTGG-3¢ (reverse) to APUM-2 and 5¢-CGATG
CAGAAATTCAGTAGCAACATGGTGGAACGATGTC
420
was measured. For each assay, at least three
independent yeast colonies were used.
Direct interaction between APUM and RNA in the
yeast three-hybrid system
To investigate direct interaction of the APUM proteins with
RNA, the yeast YBZ-1 strain [40], in which the Lex-MS2
fusion protein was stably integrated, was co-transformed
with both pYESTrp3 ⁄ APUM and one of the bait pRH5¢⁄
RNA plasmids. As a negative control, the pYESTrp3 ⁄
APUM prey was co-transformed with the transcript control
pRH5¢⁄iron responsive element or empty pRH5¢ vector.
As a positive control, yeast was co-transformed with
pYESTrp3-iron regulatory protein (IRP) and pRH5¢⁄IRE.
Transformed yeast was plated on yeast complete synthetic
medium (0.12% yeast nitrogen base, 0.5% ammonium sul-
fate, 1% succinic acid, 2% glucose, amino acid mix, 2 %
agar) lacking uracil and Trp and the b -galactosidase activ-
ity of individual colonies was determined.
C. W. Francischini and R. B. Quaggio PUF proteins in Arabidopsis
FEBS Journal 276 (2009) 5456–5470 ª 2009 The Authors Journal compilation ª 2009 FEBS 5467
Construction of the Arabidopsis RNA hybrid
library for the yeast three-hybrid screen
The Arabidopsis hybrid RNA library was constructed from
total RNA isolated from wild-type plants grown for 2 weeks
in MS medium (Murashige and Skoog medium from Sigma),
using Trizol reagent (Invitrogen), in accordance with the
manufacturer’s instructions. Random hexamer-primed
cDNAs were synthesized using the CloneMiner cDNA
Library Construction Kit (Invitrogen). Double-stranded
among the MEME selected sequences were used to compile
the APUM consensus element for searching. Phylogenetic
and molecular evolutionary analyses were performed using
the mega, version 3.1 [32]. Transcripts possessing the APBE
were searched for within the TAIR database.
Acknowledgements
We are grateful to Dr Shaker Chuck Farah and
Dr Carla Columbano de Oliveira for their helpful
comments and Dr Marvin Wickens for providing the
YBZ-1 strain. We thank Dr Jerry Ostrowski for help
in constructing the RNA library. This work was
supported by FAPESP and CNPq.
References
1 Wells DG (2006) RNA-binding proteins: a lesson in
repression. J Neurosci 26, 7135–7138.
2 Wallander ML, Leibold EA & Eisenstein RS (2006)
Molecular control of vertebrate iron homeostasis by
iron regulatory proteins. Biochim Biophys Acta 1763,
668–689.
3 Cho PF, Gamberi C, Cho-Park YA, Cho-Park IB,
Lasko P & Sonenberg N (2006) Cap-dependent transla-
tional inhibition establishes two opposing morphogen
gradients in Drosophila embryos. Curr Biol 16, 2035–
2041.
4 Colegrove-Otero LJ, Minshall N & Standart N (2005)
RNA-binding proteins in early development. Crit Rev
Biochem Mol Biol 40, 21–73.
5 Wickens M, Bernstein DS, Kimble J & Parker R (2002)
A PUF family portrait: 3¢ UTR regulation as a way of
life. Trends Genet 18, 150–157.
PUF proteins in Arabidopsis C. W. Francischini and R. B. Quaggio
5468 FEBS Journal 276 (2009) 5456–5470 ª 2009 The Authors Journal compilation ª 2009 FEBS
14 Parisi M & Lin H (1999) The Drosophila pumilio
gene encodes two functional protein isoforms that
play multiple roles in germline development, gonado-
genesis, oogenesis and embryogenesis. Genetics 153,
235–250.
15 Crittenden SL, Bernstein DS, Bachorik JL, Thompson
BE, Gallegos M, Petcherski AG, Moulder G, Barstead
R, Wickens M & Kimble J (2002) A conserved RNA-
binding protein controls germline stem cells in Caenor-
habditis elegans. Nature 417, 660–663.
16 Salvetti A, Rossi L, Lena A, Batistoni R, Deri P,
Rainaldi G, Locci MT, Evangelista M & Gremigni V
(2005) DjPum, a homologue of Drosophila Pumilio, is
essential to planarian stem cell maintenance. Develop-
ment 132, 1863–1874.
17 Moore FL, Jaruzelska J, Fox MS, Urano J, Firpo MT,
Turek PJ, Dorfman DM & Pera RA (2003) Human
Pumilio-2 is expressed in embryonic stem cells and germ
cells and interacts with DAZ (Deleted in AZoospermia)
and DAZ-like proteins. Proc Natl Acad Sci USA 100,
538–543.
18 Edwards TA, Pyle SE, Wharton RP & Aggarwal AK
(2001) Structure of Pumilio reveals similarity between
RNA and peptide binding motifs. Cell 105, 281–289.
19 Wang X, Zamore PD & Hall TM (2001) Crystal struc-
ture of a Pumilio homology domain. Mol Cell 7, 855–
865.
20 Wang X, McLachlan J, Zamore PD & Hall TM (2002)
Herschlag D (2006) Genome-wide identification of
mRNAs associated with the translational regulator
PUMILIO in Drosophila melanogaster. Proc Natl Acad
Sci USA 103, 4487–4492.
28 Eckmann CR, Crittenden SL, Suh N & Kimble J (2004)
GLD-3 and control of the mitosis ⁄
meiosis decision in
the germline of Caenorhabditis elegans. Genetics 168,
147–160.
29 Thompson BE, Lamont LB & Kimble J (2006) Germ-
line induction of the Caenorhabditis elegans vulva. Proc
Natl Acad Sci USA 103, 620–625.
30 Sonoda J & Wharton RP (1999) Recruitment of Nanos
to hunchback mRNA by Pumilio. Genes Dev 13, 2704–
2712.
31 Sonoda J & Wharton RP (2001) Drosophila brain
tumor is a translational repressor. Genes Dev 15, 762–773.
32 Kumar S, Tamura K & Nei M (2004) MEGA3: inte-
grated software for molecular evolutionary genetics
analysis and sequence alignment. Brief Bioinform 5,
150–163.
33 Cui L, Fan Q & Li J (2002) The malaria parasite Plas-
modium falciparum encodes members of the Puf RNA-
binding protein family with conserved RNA binding
activity. Nucleic Acids Res 30, 4607–4617.
34 Zamore PD, Williamson JR & Lehmann R (1997) The
Pumilio protein binds RNA through a conserved
domain that defines a new class of RNA-binding
proteins. RNA 3, 1421–1433.
35 Cheong CG & Hall TM (2006) Engineering RNA
tein associates with multiple mitochondrial transcripts
within the organelle. J Biol Chem 277, 6303–6310.
44 Bailey TL & Elkan C (1994) Fitting a mixture model by
expectation maximization to discover motifs in biopoly-
mers. Proc Int Conf Intell Syst Mol Biol 2, 28–36.
45 White EK, Moore-Jarrett T & Ruley HE (2001) PUM2,
a novel murine puf protein, and its consensus RNA-
binding site. RNA 7, 1855–1866.
46 Laux T, Mayer KF, Berger J & Jurgens G (1996) The
WUSCHEL gene is required for shoot and floral meri-
stem integrity in Arabidopsis . Development 122, 87–96.
47 Mayer KF, Schoof H, Haecker A, Lenhard M, Jurgens
G & Laux T (1998) Role of WUSCHEL in regulating
stem cell fate in the Arabidopsis shoot meristem. Cell
95, 805–815.
48 Schoof H, Lenhard M, Haecker A, Mayer KF, Jurgens
G & Laux T (2000) The stem cell population of Arabid-
opsis shoot meristems in maintained by a regulatory
loop between the CLAVATA and WUSCHEL genes.
Cell 100, 635–644.
49 Kaya H, Shibahara KI, Taoka KI, Iwabuchi M,
Stillman B & Araki T (2001) FASCIATA genes for
chromatin assembly factor-1 in Arabidopsis maintain
the cellular organization of apical meristems. Cell 104,
131–142.
50 Moussian B, Haecker A & Laux T (2003) ZWILLE
buffers meristem stability in Arabidopsis thaliana. Dev
Genes Evol 213, 534–540.
51 Caro F, Bercovich N, Atorrasagasti C, Levin MJ &
Vazquez MP (2006) Trypanosoma cruzi: analysis of the
habditis elegans PUF protein family with distinct RNA
binding specificity. RNA 14, 1550–1557.
Supporting information
The following supplementary material is available:
Table S1. List of primers used in the PUF domains
amplification.
Table S2. List of primers synthesized to cloning of
3¢ UTR transcripts in the pRH5¢ vector.
This supplementary material can be found in the
online version of this article.
Please note: As a service to our authors and readers,
this journal provides supporting information supplied
by the authors. Such materials are peer-reviewed and
may be re-organized for online delivery, but are not
copy-edited or typeset. Technical support issues arising
from supporting information (other than missing files)
should be addressed to the authors.
PUF proteins in Arabidopsis C. W. Francischini and R. B. Quaggio
5470 FEBS Journal 276 (2009) 5456–5470 ª 2009 The Authors Journal compilation ª 2009 FEBS