Identification of ATP-NADH kinase isozymes and their
contribution to supply of NADP(H) in Saccharomyces
cerevisiae
Feng Shi
1,2
, Shigeyuki Kawai
1
, Shigetarou Mori
1
, Emi Kono
1
and Kousaku Murata
1
1 Department of Basic and Applied Molecular Biotechnology, Division of Food and Biological Science, Graduate School of Agriculture,
Kyoto University, Uji, Kyoto, Japan
2 School of Biotechnology, Southern Yangtze University, Wuxi, Jiangsu, China
The genomic DNA sequence of the widely studied
yeast Saccharomyces cerevisiae, which is a model
organism for eukaryotic cells, contains three NAD kin-
ase homologues, namely, Utr1p, Pos5p and Yel041wp
[1–3]. NAD kinase (EC 2.7.1.23) catalyses NAD phos-
phorylation by using phosphoryl donors (ATP or inor-
ganic polyphosphate [poly(P)]), constituting the last
step of the NADP biosynthetic pathway [4,5]. For the
Keywords
ATP-NADH kinase; Pos5p; Saccharomyces
cerevisiae; Utr1p; Yef1p
Correspondence
K. Murata, Department of Basic and Applied
Molecular Biotechnology, Division of Food
and Biological Science, Graduate School of

buted to an ability of Leu2p of C. glabrata to use NADP as a coenzyme
and to supply NADPH.
Abbreviations
CgLEU2, LEU2 of yeast Candida glabrata; FOA, 5-fluoroorotic acid; GFP, green fluorescent protein; KNDE, 10 m
M potassium phosphate,
pH 7.0, containing 0.1 m
M NAD, 0.5 mM dithiothreitol and 1.0 mM EDTA; poly(P), inorganic polyphosphate; ScLEU2, LEU2 of yeast
Saccharomyces cerevisiae; SD, synthetic dextrose; SG, synthetic glycerol; SD+FOA+Ura, synthetic dextrose ⁄ 5-fluoroorotic acid ⁄ uracil;
WT, wild type; YPD, yeast extract ⁄ peptone ⁄ dextrose; YPG, yeast extract ⁄ peptone ⁄ glycerol.
FEBS Journal 272 (2005) 3337–3349 ª 2005 FEBS 3337
phosphoryl donor, the enzyme using ATP and poly(P)
is termed poly(P) ⁄ ATP-NAD kinase [4] and that using
ATP, but not poly(P), is termed ATP-NAD kinase [6].
For the phosphoryl acceptor, the enzyme specific to
NAD is designated NAD kinase and that phosphory-
lating both NAD and NADH is NADH kinase (EC
2.7.1.86) [2,3,7].
Utr1p, which was initially identified as an ATP-
NAD kinase, was proposed to participate in the ferri-
reductase system [1,8]. It was required for the reduc-
tion of extracellular ferric chelates to their ferrous
counterparts and for the uptake of extracellular iron.
This system consists of three components, namely,
Fre1p, NADH dehydrogenase and Utr1p. Utr1p was
proposed to contribute to the system by supplying
NADP [1,8]. However, the NADH kinase activity of
Utr1p has not yet been reported [1]. Pos5p was iden-
tified as an ATP-NADH kinase; it was shown to be
localized in the mitochondrial matrix and to be
important to several NADPH-requisite mitochondrial

mutant, which was unexpectedly viable, for UTR1,
YEF1 and POS5 and attempted to clarify the roles of
these three enzymes.
Results
Identification of Yel041wp (Yef1p) as ATP-NAD
kinase
First, we attempted to identify the function of
Yel041wp. We referred to Yel041wp as ‘Yef1p’ based
on the designation of this protein in the SWISS-PROT
database ( />bfind?sptrembl). YEF1 consists of 1488 nucleotides
encoding a polypeptide of 496 amino acid residues
with a calculated molecular mass of 55.9 kDa and a
calculated pI of 5.46. The YEF1 locus on genomic
DNA does not contain introns.
YEF1 was expressed in Escherichia coli as a fusion
recombinant protein with a V5 epitope and His
6
tag
at the C terminus. The fusion protein, referred to as
Yef1p, consisted of 533 amino acid residues and exhib-
ited the calculated molecular mass of 60.1 kDa. The cell
extract of E. coli MK746 expressing YEF1 showed
0.078 UÆmg
)1
ATP-NAD kinase activity, while that of
control strain SK45 carrying vector alone exhibited an
activity of 0.00086 UÆmg
)1
. When metaphosphate and
polyphosphate were used at 1.0 mgÆmL

(%)
Specific
activity
(UÆmg
)1
)
Purification
(fold)
Cell extract 2808 218 100 0.078 1
DEAE–Toyopearl 331 205 94 0.619 8.0
Butyl-Toyopearl 15.1 13.4 6.1 0.886 11.4
Ni–chelate AF
Toyopearl
0.9 8.5 3.9 9.475 122
Saccharomyces cerevisiae NADH kinases F. Shi et al.
3338 FEBS Journal 272 (2005) 3337–3349 ª 2005 FEBS
enolpyruvate at 5 mm) were not utilized, thereby indi-
cating that Yef1p was an ATP-NAD kinase. K
m
for
NAD and ATP were 1.9 mm and 0.17 mm, respectively.
Properties of Yef1p and identification of Yef1p
and Utr1p as ATP-NADH kinases
The enzyme had an optimum pH of 8.5 in Tris ⁄ HCl
(Fig. 2A), the optimal temperature was 45 °C (Fig. 2B)
and half of its activity was lost on treatment at 54 °C
for 10 min (Fig. 2C). Bivalent metal ions such as Mg
2+
,
Mn

NADPH and NADH slightly inhibited Yef1p; however,
NADP and intermediates involved in NAD biosynthesis
(nicotinic acid mononucleotide, nicotinic acid adenine
dinucleotide, nicotinic acid and quinolinic acid) did not
inhibit Yef1p (Table 2). HgCl
2
inhibited enzyme activity
(Table 2), thereby indicating the importance of the SH
group of the enzyme for its catalytic activity.
We also found that Yef1p exhibited NADH kinase
activity in the presence of ATP, but not poly(P)
(1 mgÆmL
)1
metaphosphate). On assaying the NADH
kinase activity of purified Utr1p [1], a similar result
was obtained. K
m
for NADH of Yef1p was 2.0 mm
AB
Fig. 1. Molecular mass of Yef1p. (A) SDS ⁄
PAGE of Yef1p. Lane 1, protein markers
(Bio-Rad); lane 2, purified enzyme (1.5 lg).
(B) Gel filtration of Yef1p. Purified Yef1p
was loaded on a Superdex 200 pg column
and was eluted as described in Experimen-
tal procedures. The arrow (s) indicates the
elution volume (Ve) of the purified Yef1p.
Protein standards (d) were as follows:
(a) blue dextran 2000 (2000 kDa); (b)
tyroglobulin (669 kDa); (c) ferritin (440 kDa);

max
value of the NAD
of Yef1p (1.7 mmÆmin
)1
ÆU
)1
) and Utr1p (1.2 mmÆ
min
)1
ÆU
)1
), respectively. K
m
and V
max
for NAD and
NADH of Pos5p have not been reported [2,3].
Constructions of double and triple mutants for
UTR1, YEF1 and POS5
To examine the roles of Yef1p, Utr1p and Pos5p, we
attempted to construct double and triple mutants for
UTR1, YEF1 and POS5. Tables 3, 4 and 5 list the yeast
strains, plasmids and primers, respectively, used in this
study. We hypothesized that the triple mutant (utr1yef1-
pos5) may be lethal due to the proposed significance of
intracellular NADP and NADPH; therefore, we con-
structed a triple mutant carrying UTR1 on YCplac33
(MK1208, utr1yef1pos5 YCp-UTR1) by replacing
POS5 in MK933 (utr1yef1 YCp-UTR1) with CgLEU2
(LEU2 of Candida glabrata, GenBank ID CGU90626)

0.1 75
NADP 0.05 100
0.1 100
Nicotinic acid mononucleotide 1.0 100
Nicotinic acid adenine dinucleotide 1.0 100
Nicotinic acid 1.0 100
Quinolinic acid 1.0 100
2-Mercaptoethanol 1.0 100
Dithiothreitol 1.0 100
Glutathione (reduced form) 1.0 100
HgCl
2
0.1 13
0.25 6
Table 3. S. cerevisiae strains used in this study.
Strain Genotype Source
BY4742 MATa leu2D0 lys2D0 ura3D0 his3D1 EUROSCARF
MK424 MATa leu2D0 lys2D0 ura3D0 his3D1 utr1::kanMX4 EUROSCARF
MK425 MATa leu2D0 lys2D0 ura3D0 his3D1 pos5::kanMX4 EUROSCARF
MK426 MATa leu2D0 lys2D0 ura3D0 his3D1 yef1::kanMX4 EUROSCARF
MK353 MATa leu2D0 lys2D0 ura3D0 his3D1 ftr1::kanMX4 EUROSCARF
MK710 MATa leu2D0 lys2D0 ura3D0 his3D1 zwf1::kanMX4 EUROSCARF
MK743 MATa leu2D0 lys2D0 ura3D0 his3D1 utr1::kanMX4 yef1::HIS3 This study
MK803 MATa leu2D0 lys2D0 ura3D0 his3D1 utr1::kanMX4 pos5::HIS3 This study
MK804 MATa leu2D0 lys2D0 ura3D0 his3D1 yef1::kanMX4 pos5::HIS3 This study
MK933 MATa leu2D0 lys2D0 ura3D0 his3D1 utr1::kanMX4 yef1::HIS3 YCp-UTR1 This study
MK1208 MATa leu2D0 lys2D0 ura3D0 his3D1 utr1::kanMX4 yef1::HIS3 pos5::CgLEU2 YCp-UTR1 This study
MK1219 MATa leu2D0 lys2D0 ura3D0 his3D1 utr1::kanMX4 yef1::HIS3 pos5::CgLEU2 This study
MK751 MATa leu2D0 lys2D0 ura3D0 his3D1 pos5::kanMX4 YEp13 This study
MK1223 MATa leu2D0 lys2D0 ura3D0 his3D1 pos5::kanMX4 pRS415 This study

[34]
pCgLEU2 Gene deletion vector, CgLEU2
a
,Ap
r
YGRC
YEplac195 E. coli ⁄ S. cerevisiae shuttle vector, URA3,2lm, Ap
r
[13]
YEp-UTR1 UTR1 flanking 5¢ 503 bp in YEplac195 This study
YEp-POS5 POS5 flanking 5¢ 406 bp in YEplac195 This study
YEp-YEF1 YEF1 flanking 5¢ 503 bp in YEplac195 This study
YCplac33 E. coli ⁄ S. cerevisiae shuttle vector, URA3, CEN,Ap
r
[13]
YCp-UTR1 UTR1 flanking 5¢ 503 bp in YCplac 33 This study
YEp13 E. coli ⁄ S. cerevisiae shuttle vector, ScLEU2
b
,2lm, Ap
r
[13]
pRS415 E. coli ⁄ S. cerevisiae shuttle vector, ScLEU2
b
, CEN,Ap
r
[13]
pFA6a-GFP(F64A, S65T, Gene modification vector, GFP, HIS3,Ap
r
[29]
R80Q, V163A) -His3MX6

CTTAGAGAATCTCATTGAATCTTTGCATTCAGAGCGT
TTAGTAAAGTTCGTTTGCCGATACATG
yef1up0.5kb
CGTTATGAAAATCACTATTATCCCC
yef1-HindIII AAAAGC
TTAGATTGCAAAATGAGCCTGACGA
pos5up0.4kb
GCTATGAAAGTCAATCCTTTTAATCG
pos5-HindIII GAAAGC
TTAATCATTATCAGTCTGTCTCTTGG
utr1up0.5kb
GCCACTGCCATCTCTTCCATTCTTTG
utr1-BamHI ATGGATCC
TTATACTGAAAACCTTGCTTGAGAAG
F. Shi et al. Saccharomyces cerevisiae NADH kinases
FEBS Journal 272 (2005) 3337–3349 ª 2005 FEBS 3341
and double mutants and the wild-type (WT, BY4742)
cell, although the triple mutant (utr1yef1pos5) did not
(Fig. 3). The growth defect of pos5 mutants probably
reflected the mitochondrial dysfunction caused by the
deletion of POS5 [2,3]. The absence of growth defects
in the triple mutant suggested that CgLEU2, which
was used for the disruption of POS5 in the utr1yef1
cell to construct triple mutant, can complement the
growth defect of pos5 mutants.
All mutants exhibited proper growth on solid med-
ium lacking methionine (data not shown), the med-
ium on which we confirmed that the zwf1 cell
exhibited growth defect as reported elsewhere [2,9–
11] (data not shown). Growth defects of the pos5

cose), YPD low dextrose (0.2% glucose) and YPG (3% glycerol)
liquid media until D
600
of 0.05. The cells were cultivated aerobically
at 30 °C and their growth was monitored by following D
600
every
4 h. Averages in two independent experiments are provided.
A
B
Fig. 4. Growth phenotypes of the mutants
for UTR1, YEF1 and POS5. (A) The mutants
and WT cells that were cultivated in SD
liquid medium to saturation were washed
three times in sterilized water and spotted
as described in Experimental procedures on
SD solid medium (control), SD solid media
without arginine (–Arg), with 2 m
M hydrogen
peroxide (+H
2
O
2
) and SG solid medium
(SG). (B) pos5 mutants lacking ScLEU2
(pos5), carrying ScLEU2 on high copy vector
(pos5 YEp13), low copy vector (pos5
pRS415) and carrying CgLEU2 on chromo-
some (pos5::CgLEU2) were treated and
spotted as in (A).

At higher temperature (37 °C) on SD solid medium,
pos5 single mutant showed a slight growth defect, and
the deletion of UTR1 or YEF1 and particularly of
both UTR1 and YEF1 from the pos5 cell enhanced the
growth defect (Fig. 6). However, utr1yef1 and the
other single mutants did not exhibit growth defects at
37 °C (Fig. 6), thereby indicating that Pos5p is a crit-
ical contributor to the survival of the cells at 37 °Con
SD solid medium; Utr1p or Yef1p and in particular,
both Utr1p and Yef1p can contribute significantly to
the survival only in the absence of main contributor
(Pos5p). On YPD solid medium, the growth defect was
alleviated (Fig. 6).
Growth phenotypes of mutants for UTR1, YEF1
and POS5 in low iron medium
Because Utr1p is proposed to participate in the ferri-
reductase system required for low iron uptake, the utr1
cell was expected to exhibit growth defect on the low
iron medium [1,8]. As expected, utr1 exhibited lower
growth in the low iron medium than the yef1 and pos5
single mutants (Fig. 7). The deletion of YEF1 or POS5
from utr1 further decreased the growth of utr1 to the
same level as that of the ftr1 mutant, which lacks a
high-affinity iron transporter and shows severe growth
defects in the low iron medium [14] (Fig. 7). Further-
more, the deletion of both YEF1 and POS5 from utr1
Table 6. Doubling time of WT (BY4742) and pos5 mutants. Means
of two independent experiments are provided. Arginine concentra-
tions are specified in parentheses in mgÆL
)1

media (glycerol) with (+Arg) and without
(–Arg) arginine.
F. Shi et al. Saccharomyces cerevisiae NADH kinases
FEBS Journal 272 (2005) 3337–3349 ª 2005 FEBS 3343
decreased the growth to a level that was much lower
than that of the ftr1 mutant (Fig. 7). It should be
noted that in the presence of Utr1p, the mutants (yef1,
pos5 and yef1pos5 cells) did not exhibit growth defects
(Fig. 7), thereby indicating that Utr1p is a critical con-
tributor to growth in the low iron medium and that
Yef1p or Pos5p and, in particular, both Yef1p and
Pos5p can contribute significantly to this kind of
growth only in the absence of the critical contributor
(Utr1p).
Discussion
The genomic sequence of the yeast S. cerevisiae con-
tains three NAD kinase homologues, i.e. Utr1p, Pos5p
and Yel041wp [1–3]. In this study, we termed
Yel041wp ‘Yef1p’. Among the three proteins, only the
function of Yef1p was not identified biochemically;
therefore, it was termed the ‘function-unknown’ pro-
tein. We identified that Yef1p functions as an ATP-
NADH kinase by using recombinant protein expressed
in E. coli. We also confirmed that Utr1p, initially
identified as an ATP-NAD kinase [1], was in fact an
ATP-NADH kinase. Thus, the three isozymes of NAD
kinase, namely, Utr1p, Yef1p and Pos5p, were bio-
chemically identified as ATP-NADH kinases [1–3].
Yef1p exhibited a homooctameric structure consist-
ing of 60-kDa subunits, while Utr1p exhibited a homo-

to saturation and further cultivated for 24 h after a 100-fold dilution
of the saturated culture by the same fresh medium. The cells were
washed three times in sterilized redistilled water and inoculated
into 3 mL SD (filled bar) and low iron (open bar) liquid media to give
D
600
of 0.05 (SD) and of 0.20 (low iron). The cells were cultivated
aerobically at 30 °C, and growth was monitored by following the
D
600
. Bars represent the relative D
600
(%) of the cultures in the sta-
tionary phase (SD, after 34 h; low iron, after 100 h), taking D
600
(%) of the WT cell in each medium (SD, D
600
of 5.8; low iron, D
600
of 2.4) as 100%. Means of two independent experiments are pro-
vided.
Saccharomyces cerevisiae NADH kinases F. Shi et al.
3344 FEBS Journal 272 (2005) 3337–3349 ª 2005 FEBS
NADPH, NADH and NADP [1], respectively, thereby
suggesting a difference in the regulation of Yef1p and
Utr1p by these compounds.
The viability of the triple mutant for the three
NADH kinase genes (UTR1, YEF1 and POS5)at
30 °C was unexpected. NAD and NADH kinases have
been regarded as the sole enzymes producing NADP

ondrial functions and survival at 37 °C, and the critical
contribution of Utr1p in supporting growth in a low
iron medium. The contributions of the other two
enzymes were shown only in the absence of the critical
contributor, which was supported by the complementa-
tion of certain pos5 phenotypes through the over-
expression of UTR1 or YEF1 (Figs 4A,5,6,7; Table 6).
Furthermore, the alleviated temperature sensitivity of
the pos5 mutants on YPD solid medium when com-
pared with that on SD solid medium (Fig. 6) may be
indicative of the significance of NADP and NADPH
in biosynthetic reactions, which is in agreement with
the well-accepted concept that NADP and NADPH
are involved primarily in biosynthetic reactions, while
NAD and NADH are involved primarily in catabolic
reactions [24].
Although the critical contribution of Yef1p alone to
specific cellular function was not observed in this
study, a difference in the regulation of Yef1p and
Utr1p by NADPH, NADH and NADP (Table 2) [1],
and the different transcriptional patterns and protein–
protein interactions of Yef1p, Utr1p and Pos5p [25–
27] may be indicative of a certain critical contribution
of Yef1p. In brief, for example, transcriptions of
YEF1 are repressed under anaerobic conditions and in
the presence of ethanol stress; however, those of
UTR1 and POS5 are not affected [25,26]. Two-hybrid
analysis indicated that Yef1p interacted with Utr1p
and the ‘function-unknown’ proteins (Yor315wp,
Yhr115cp and Ykl009wp). On the other hand, Utr1p

the GFP-fusion proteins and ⁄ or the sensitivity of the
detection system.
Finally, we also found that CgLEU2 (LEU2 of
C. glabrata), but not ScLEU2 (LEU2 of S. cerevisiae),
complemented certain pos5 phenotypes (Fig. 4). LEU2
encodes b-isopropylmalate dehydrogenase that cata-
lyses the oxidation of b-isopropylmalate by using
NAD, but not NADP [30]. ScLeu2p reportedly uses
NAD, but not NADP (< 5% efficiency) [30]; it was
F. Shi et al. Saccharomyces cerevisiae NADH kinases
FEBS Journal 272 (2005) 3337–3349 ª 2005 FEBS 3345
also reported to be localized in the cytosol [31]. No
positive sequence was detected in ScLeu2p during the
computer program analysis using ipsort, thereby sup-
porting the cytosolic localization of ScLeu2p. The co-
enzyme specificity and localization of CgLeu2p have
not been reported. However, ipsort did not show any
positive sequence in CgLeu2p, possibly suggesting that
CgLeu2p was localized in the cytosol. Collectively, we
assume that cytosolic CgLeu2p has the ability to utilize
NADP and that it supplies cytosolic NADPH, whereas
cytosolic ScLeu2p cannot provide NADPH due to its
specificity to NAD. In the triple mutant (utr1yef1pos5),
cytosolic NADP might be supplied by the ‘novel’
enzyme, being different from Utr1p, Yef1p, and Pos5p,
as discussed above. In this context, we assume that the
adequate amount of cytosolic NADPH that is being
provided by CgLeu2p is possibly transported into the
mitochondria via an unidentified transporter localized
in the mitochondrial membrane. This results in comple-

materials are provided in the text.
Strains
Strains of S. cerevisiae were cultured at 30 °C in nutrient-
rich yeast extract ⁄ peptone ⁄ dextrose (YPD) medium [1%
(w ⁄ v) yeast extract, 2% (w ⁄ v) peptone, 2% (w ⁄ v) glucose;
pH 5.0), if necessary, with 0.2 mgÆmL
)1
geneticin or in syn-
thetic dextrose (SD) medium [0.67% (w ⁄ v) yeast nitrogen
base without amino acids, 2% (w ⁄ v) glucose, and appropri-
ate amino acids; pH 5.0]. Glucose was replaced with 3%
(v ⁄ v) glycerol in the synthetic glycerol (SG) medium and
the YPG medium. The concentration of glucose was chan-
ged to 0.2% and 20% (w ⁄ v) for YPD low dextrose medium
and YPD high dextrose medium, respectively. The low iron
medium was composed of 0.67% (w ⁄ v) yeast nitrogen base
without ferric chloride and copper sulfate, 40 lgÆmL
)1
CuCl
2
,2%(w⁄ v) glucose, 50 mm 2-morpholinoethanesulf-
onic acid, pH 6.1, 1 mm ferrozine and appropriate amino
acids [14]. The SD+FOA+Ura medium was composed of
0.7% (w ⁄ v) yeast nitrogen base without amino acid, 2%
(w ⁄ v) glucose, 0.1% FOA, 50 mgÆL
)1
uracil and appropri-
ate amino acids [12]. The SD+FOA+Ura medium was
similar; however, FOA and uracil were not included. In
order to prepare solid media, liquid media were solidified

E. coli was inserted upstream of the start codon of YEF1
(Table 5). The use of pET-DEST42 enabled us to fuse a V5
epitope and a His
6
tag to the C-terminal of Yef1p. E. coli
BL21(DE3) was transformed with pET-YEF1 and pET-
DEST42 to yield MK746 and SK45, respectively.
Saccharomyces cerevisiae NADH kinases F. Shi et al.
3346 FEBS Journal 272 (2005) 3337–3349 ª 2005 FEBS
Expression of YEF1 in E. coli
For YEF1 expression, MK746 was inoculated into 400 mL
of Luria–Bertani medium supplemented with 100 lgÆmL
)1
ampicillin and subsequently cultured at 37 °C aerobically
until D
600
reached 1.2. This culture was transferred to the
same medium (12.0 L), and aerobic cultivation was contin-
ued at 37 °C for 5 h until D
600
reached 0.80. Isopropyl
thio-b-d-galactoside was then added to a final concentra-
tion of 0.4 mm, and cultivation was continued further at
37 °C aerobically for 5 h. As a control, SK45 in 10 mL
medium was treated in a similar manner.
Assay of NAD kinase activity
ATP-NAD kinase activity was assayed at 30 °C as des-
cribed previously with a slight modification [4]. In brief, the
formation of NADPH was continuously measured at A
340

5.0 mm ATP, 5.0 mm MgCl
2
, 100 mm Tris ⁄ HCl (pH 8.0)
and an appropriate amount of enzyme was incubated at
30 °C. Enzyme solution of less than 100 lL was routinely
added to the reaction mixture. The reaction was terminated
by the addition of 0.1 mL of 1 m NaOH followed by imme-
diate immersion of the test tube in boiling water for
1.5 min. The mixture was neutralized by the addition of
0.3 mL neutralization solution consisting of 500 mm trieth-
anolamine ⁄ HCl (pH 7.8), 400 mm Tris ⁄ HCl (pH 7.8),
25 mm NH
4
Cl and 25 mm a-ketoglutarate. NADH and the
NADPH thus formed were enzymatically oxidized to NAD
and NADP by the addition of 12.5 U glutamate dehydroge-
nase, followed by incubation at 30 °C for 10 min. Oxida-
tion was monitored by observing the decrease in A
340
.
After the oxidation reaction was terminated by immersing
the test tube in boiling water for 5 min, the amount of
NADP was determined as described above. One unit (U) of
enzyme activity was defined as 1.0 lmol NADPH produced
for 1 min at 30 °C in an initial reaction mixture (1.0 mL),
and specific activity was expressed in UÆmg
)1
protein. V
max
was determined using 1.0 U Yef1p or Utr1p, being defined

were obtained on elution with 150–220 mm imidazole were
combined, dialysed against KNDE and used as purified
Yef1p.
Other analyses
SDS ⁄ PAGE was conducted using a 12.5% polyacrylamide
gel as described elsewhere [33]. The proteins in the gel were
visualized with Coomassie brilliant blue R-250. The
molecular mass of the enzyme was calculated by gel filtra-
tion chromatography on a Superdex 200 pg column
(1.6 · 60 cm) (Amersham Pharmacia Biotech, Piscataway,
NJ, USA) with A
¨
KTA purifier (Amersham Pharmacia Bio-
F. Shi et al. Saccharomyces cerevisiae NADH kinases
FEBS Journal 272 (2005) 3337–3349 ª 2005 FEBS 3347
tech) by using KNDE containing 150 mm NaCl as the elu-
tion buffer, as recommended by the manufacturer. The
molecular mass and pI of the polypeptide were calculated
with the genetyx program (Software Development, Tokyo,
Japan). The localization of proteins was predicted by
ipsort ( [28],
which predicts the mitochondrial targeting sequence and
the N-terminal signal sequence for targeting proteins to the
endoplasmic reticulum for subsequent transport through
the secretory pathway.
Construction of mutants for UTR1, YEF1 and
POS5
Mutants for UTR1, YEF1 and POS5 were constructed by
PCR targeting [34] as follows: HIS3 flanking approximately
40 nucleotides upstream and downstream of YEF1 was

MK425 (pos5) was transformed with YEp-UTR1, YEp-
POS5, YEp-YEF1 and YEplac195, thereby yielding
MK739 (pos5 YEp-UTR1), MK740 (pos5 YEp-POS5),
MK741 (pos5 YEp-YEF1) and MK742 (pos5 YEplac195).
UTR1 in addition to upstream 503 bp DNA was inserted
into the SmaI site of YCplac33 in order to produce
YCp-UTR1, which was then introduced into MK743
(utr1yef1), yielding MK933 (utr1yef1 YCp-UTR1). pos5
single mutant (MK425) was transformed with YEp13 and
pRS415, yielding MK751 (pos5 YEp13) and MK1223 (pos5
pRS415), respectively.
Acknowledgements
We thank Dr S. Harashima, Osaka University, for
helping us receive pCgLEU2 from the Yeast Genetic
Resource Centre. This work was supported in part
by a Grant-in-Aid from the Ministry of Education,
Culture, Sports, Science and Technology of Japan
(15780212) and by the Program for Promotion of
Basic Research Activities for Innovative Biosciences
(PROBRAIN).
References
1 Kawai S, Mori S, Suzuki S & Murata K (2001) Molecu-
lar cloning and identification of UTR1 of a yeast Sac-
charomyces cerevisiae as a gene encoding an NAD
kinase. FEMS Microbiol Lett 200, 181–184.
2 Outten CE & Culotta VC (2003) A novel NADH kinase
is the mitochondrial source of NADPH in Saccharo-
myces cerevisiae. EMBO J 22, 2015–2024.
3 Strand MK, Stuart GR, Longley MJ, Graziewicz MA,
Dominick OC & Copeland WC (2003) POS5 gene of

phate pathway play overlapping roles in oxidative stress
protection. J Biol Chem 271, 28831–28836.
11 Thomas D, Cherest H & Surdin-Kerjan Y (1991) Identi-
fication of the structural gene for glucose-6-phosphate
dehydrogenase in yeast. Inactivation leads to a nutri-
tional requirement for organic sulfur. EMBO J 10, 547–
553.
12 Boeke JD, Trueheart J, Natsoulis G & Fink GR (1987)
5-Fluoroorotic acid as a selective agent in yeast mole-
cular genetics. Methods Enzymol 154, 164–175.
13 Gietz RD & Sugino A (1988) New yeast-Escherichia coli
shuttle vectors constructed with in vitro mutagenized
yeast genes lacking six-base pair restriction sites. Gene
74, 527–534.
14 Stearman R, Yuan DS, Yamaguchi-Iwai Y, Klausner
RD & Dancis A (1996) A permease-oxidase complex
involved in high-affinity iron uptake in yeast. Science
271, 1552–1557.
15 Bulter JR & McGuinness ET (1982) Candida utilis
NAD+ kinase: purification, properties and affinity gel
studies. Int J Biochem 14, 839–844.
16 Apps DK (1975) Pigeon-liver NAD kinase. The struc-
tural and kinetic basis of regulation of NADPH. Eur J
Biochem 55, 475–483.
17 Lerner F, Niere M, Ludwing A & Ziegler M (2001)
Structural and functional characterization of human
NAD kinase. Biochem Biophys Res Commun 288, 69–74.
18 Raffaelli N, Finaurini L, Mazzola F, Pucci L, Sorci L,
Amici A & Magni G (2004) Characterization of Myco-
bacterium tuberculosis NAD kinase: functional analysis

26 ter Linde JJM, Liang H, Davis RW, Steensma HY, van
Dijken JP & Pronk JT (1999) Genome-wide transcrip-
tional analysis of aerobic and anaerobic chemostat cul-
tures of Saccharomyces cerevisiae. J Bacteriol 181, 7409–
7413.
27 Ito T, Chiba T, Ozawa R, Yoshida M, Hattori M &
Sakaki Y (2001) A comprehensive two-hybrid analysis
to explore the yeast protein interactions. Proc Natl Acad
Sci USA 98, 4569–4574.
28 Bannai H, Tamada Y, Maruyama O, Nakai K &
Miyano S (2002) Extensive feature detection of N-term-
inal protein sorting signals. Bioinformatics 18, 298–305.
29 Longtine MS, McKenzie A 3rd, Demarini DJ, Shah
NG, Wach A, Brachat A, Philippsen P & Pringle JR
(1998) Additional modules for versatile and economical
PCR-based gene deletion and modification in Saccharo-
myces cerevisiae. Yeast 14, 953–961.
30 Hsu YP & Kohlhaw GB (1980) Leucine biosynthesis in
Saccharomyces cerevisiae. Purification and characteriza-
tion of beta-isopropylmalate dehydrogenase. J Biol
Chem 255, 7255–7260.
31 Ryan ED, Tracy JW & Kohlhaw GB (1973) Subcellular
localization of the leucine biosynthetic enzymes in yeast.
J Bacteriol 116, 222–225.
32 Bradford MM (1976) A rapid and sensitive method for
the quantitation of microgram quantities of protein util-
izing the principle of protein dye-binding. Anal Biochem
72, 248–254.
33 Laemmli UK (1970) Cleavage of structural proteins
during the assembly of the head of bacteriophage T4.