Suppression of a cold-sensitive mutant initiation factor 1
by alterations in the 23S rRNA maturation region
Jaroslav M. Belotserkovsky, Georgina I. Isak and Leif A. Isaksson
Department of Genetics, Microbiology and Toxicology, Stockholm University, Sweden
Introduction
Bacterial protein synthesis, as directed by the action of
the ribosome, can be broadly divided into four main
phases – initiation, elongation, termination, and recy-
cling. Initiation is the rate-limiting step [1]. This phase
is mediated by initiation factor 1 (IF1), initiation fac-
tor 2, and initiation factor 3. IF1 is the smallest of the
initiation factors [2]. Its structure has been determined
by NMR spectroscopy, revealing that IF1 is a member
of the oligomer-binding (OB-fold) family of proteins,
with structural similarities to cold shock proteins [3].
In addition, IF1 has been shown to complement
lesions in several cold shock response proteins in Bacil-
lus subtilis [4]. The interaction of IF1 with the bacterial
ribosome has been investigated by chemical probing
[5], mutagenesis studies [6], and crystallography [7,8].
These data indicate that IF1 makes contacts with the
functionally important bases G530, A1492 and A1493
in 16S rRNA. In addition to its direct involvement in
translation initiation [1], IF1 has been shown to be an
RNA chaperone [9], as well as playing a role in tran-
scriptional antitermination in Escherichia coli [10].
More recently, it has been reported that IF1 acts as a
sensor of cis-elements in mRNA [11] and, together
with initiation factor 3, determines the rates of ribo-
somal subunit joining by inducing conformational
changes in the 30S subunit [12].
of precursor 23S rRNA. These mutations interfere with processing of the 23S
rRNA termini. A lesion of RNase III also suppresses the cold sensitivity.
Our results suggest that the mutant IF1 strain is perturbed at the level of
ribosomal subunit association, and the suppressor mutations partially com-
pensate for this defect by disrupting rRNA maturation. These results support
the notion that IF1 is an RNA chaperone and that translation initiation is
coupled to ribosomal maturation.
Abbreviations
Amp, ampicillin; Cm, chloramphenicol; IF1, initiation factor 1; Kan, kanamycin; Tet, tetracycline; TIR, translation initiation region.
FEBS Journal 278 (2011) 1745–1756 ª 2011 The Authors Journal compilation ª 2011 FEBS 1745
to eventually produce mature rRNA termini [14,15].
The processing of 23S rRNA is strictly dependent on
the action of RNase III. A deletion in the gene encod-
ing this enzyme results in immature 23S rRNA with
extended termini, whereas 16S rRNA is matured to
completion [16].
There is ample evidence that the maturation of the
two ribosomal subunits is interdependent, and that
subunit maturation events are functionally linked to
translation initiation [13]. Here, we have isolated muta-
tions in the 23S rRNA processing stem that suppress a
cold-sensitive mutant of IF1. This serves as additional
evidence that ribosome maturation and translation
initiation are intimately linked.
Results
Mutations in the processing stem of 23S rRNA
The existence of D7 E. coli strains, in which all seven
rRNA operons are deleted, has facilitated studies with
rRNA that exists as genetically pure populations of
cellular ribosomes. This is possible because a plasmid
shift (Fig. 3). The obvious question was whether these
mutations have any effect on 23S stem processing. Pri-
mer extension analyses were used to check the termini
of 23S rRNA from total cellular extracts in these
mutants. Additional bands corresponding to accumula-
tion of precursors of 23S rRNA in mutant plasmids
were detected (Fig. 4A). The expected 5¢ mature and
)7 termini, as well as additional bands corresponding
to approximate )41 (e1) and )46 (e2) termini, were
identified in strains carrying the mutant plasmids. pD1
and pD6, which carry mutations on the 5¢-side of the
processing stem, gave rise to rRNA with the majority
of termini in the mature form, whereas pD3, with a
mutation on the 3¢-side, gave rise rRNA with the
majority of the termini in the )7 form. In addition, for
Fig. 1. Secondary structure of 23S rRNA processing stem, show-
ing sites of suppressor mutations. Cleavage sites of RNase III on
naked RNA (solid arrows) and on the ribosome (dashed arrows) are
indicated. The sequence of mature termini of 23S rRNA is in bold.
Sites of mutations are encircled. Mutants are designated as fol-
lows: pD1 and pD6 carry mutations in position G8, and are G to T
and G to A substitutions, respectively. pD3 has a C to A substitu-
tion at position C + 2. Figure reproduced from [18].
Processing stem mutations suppress cold-sensitive IF1 J. M. Belotserkovsky et al.
1746 FEBS Journal 278 (2011) 1745–1756 ª 2011 The Authors Journal compilation ª 2011 FEBS
pD1, the e1 ()41) terminus was more prominent. Thus,
there were apparent differences between the mutant
plasmids in extended termini, depending on the
mutated position in the processing stem. Taken
together, these results suggest that the processing stem
was to avoid potential disruption or polar effects on
the downstream and overlapping ORF that encodes
the essential Era GTPase [19]. We found that the
RNase III lesion in JB69 resulted in the same apparent
phenotype as the 23S processing stem mutations when
Fig. 2. Phenotype of cold-sensitive IF1 mutants with various suppressors. (A) A plate incubated at 23 °C for 72 h with the D7-derived
strains, where: IF1 is pKK3535 ⁄ JB69; IF1Drnc is pKK3535 ⁄ JB69Drnc; IF1 + pD1, pD3 and pD6 are suppressor plasmids pD1, pD3 and pD6
in JB69, respectively. (B) A plate incubated at 20 °C for 72 h with the MG1655-derived strains, where: IF1 is CVR69L; IF1Drnc is
CVR69LDrnc.
Fig. 3. Growth properties of suppressor, wild-type and IF1 strains
in rich liquid medium. Cultures were grown to D
590 nm
0.2 at 37 °C,
after which they were shifted to 23 °C (shown as dotted line).
Growth trajectories of strains are labeled as follows: ¤,
pKK3535 ⁄ SQZ10; j, pD3 ⁄ JB69; m, pKK3535 ⁄ JB69;
•
, pKK3535 ⁄
JB69Drnc. Suppressor plasmids pD1 and pD6 in JB69 are omitted
for clarity, as they have identical trajectories to pD3 ⁄ JB69. Straight
lines were fitted to data generated from at least three independent
experiments.
J. M. Belotserkovsky et al. Processing stem mutations suppress cold-sensitive IF1
FEBS Journal 278 (2011) 1745–1756 ª 2011 The Authors Journal compilation ª 2011 FEBS 1747
the strain was grown on solid medium (Fig. 2A). How-
ever, in rich liquid medium, the suppression effect was
less apparent for this strain (Fig. 3). It can be seen
that, in these culture conditions, the rnc strain had a
different growth trajectory from the processing stem
mutants (pD3). This suggests that the RNase III-
there was a total absence of a fully mature 23S termi-
nus; instead, a slightly truncated product was
observed. To rule out any possible involvement of Era
in cold sensitivity suppression of mutant IF1, we
cloned the era ORF (which is immediately downstream
of rnc) under control of an isopropyl thio-b-d-galacto-
side-inducible promoter. No cold sensitivity suppres-
sion was observed either with or without isopropyl
thio-b-d-galactoside induction when the era plasmid
was introduced into CVR69L (not shown). In fact,
overexpression of Era was deleterious at both 20 °C
and 37 °C, consistent with another report [20]. The
corresponding experiment could not be performed in
JB69, owing to the presence of multiple plasmids in
this strain. Taken together, our results suggest the
RNase III deletion results in suppression of cold sensi-
tivity JB69, probably as a result of incomplete matura-
tion of 23S rRNA, as is also the case with the
processing stem mutants. However, other effects asso-
ciated with this lesion could also account for the
suppressor phenotype.
The IF1 mutant has an altered sucrose gradient
ribosomal profile when shifted to 23
°
C
Having shown that processing of rRNA is involved in
the suppression phenotype, we next examined how
such processing defects would affect sucrose gradient
ribosomal profiles of the mutant strains. As the sup-
pressor effect is manifested in the cold, we employed a
buffer and applied to the same gradients,
with similar results (not shown). First, both the
sucrose gradient profiles and the accompanying quanti-
fication suggest that JB69 exhibits a decreased ratio of
free 30S and 50S subunits relative to 70S particles as
compared with SQZ10. Thus, throughout the Mg
2+
titration range, there was an increased proportion of
70S particles relative to the free subunits. This was evi-
dent when looking at the amount of 30S subunits that
were incorporated into the 70S particles as a percent-
age of the total amount of 30S (value a in Fig. 5). In
SQZ10, this value ranged from 33% to 58% through-
out the Mg
2+
titration range, whereas in JB69, it ran-
ged from 50% to 60% at the same Mg
2+
concentrations. When the traces and the quantification
of peak areas in JB69 and SQZ10 were examined, it
appeared that there was a stoichoimetric imbalance of
30S and 50S subunits, whereby the 30S subunits were
in excess in JB69. This was noticeable at lower Mg
2+
concentrations, when only 33% of the subunits (30S)
were in the 70S particles in SQZ10, as compared with
50% in JB69. However, there was little difference in
the stoichiometric amounts of 30S and 50S subunits
between these two strains in the 20 mm Mg
2+
2+
titration range (com-
pare traces and 30S ⁄ 50S ratios of pD3 to pKK3535 in
each strain background). In addition, whenever pD3
was the sole source of rRNA, there was a slight
decrease in the degree of subunit association in both
SQZ10 and JB69 (compare value a in the correspond-
ing traces). Finally, when traces of the rnc lesion strain
(JB69Drnc) were examined, it was apparent that there
J. M. Belotserkovsky et al. Processing stem mutations suppress cold-sensitive IF1
FEBS Journal 278 (2011) 1745–1756 ª 2011 The Authors Journal compilation ª 2011 FEBS 1749
was a decrease in the total amount of ribosomal parti-
cles (30S, 50S, and 70S) as compared with all other
traces, even though the same amount of material was
applied to the gradients. This decrease was consistent
and occurred throughout the Mg
2+
titration. This sug-
gests that the total pool of ribosomes in this strain is
decreased, most likely as a result of improper matura-
tion of rRNA. However, this effect could also be
growth rate-related, as JB69Drnc has a long lag phase
in the downshift condition (Fig. 3). Interestingly, the
Fig. 5. Sucrose gradient profiles of ribosomes at different Mg
2+
concentrations. Each column is designated with the respective strain,
where: pKK3535 is the wild-type rrnB+ plasmid; pD3 is a processing stem mutant plasmid; SQZ10 is the wild-type strain (IF1wt); JB69 is
the IF1 mutant strain (IF1R69L); JB69Drnc is the IF1 mutant with a deleted RNase III gene. Rows are designated with the corresponding
Mg
2+
examined sucrose gradient profiles of the original
CVR69L IF1 mutant and its parental wild-type
strain, MG1655, when subjected to the same down-
shift to 23 °C (Fig. 7). Here, a similar profile was
observed as in the case of JB69 as compared with
SQZ10. There was an increase in the relative amount
of 70S particles as compared with free subunits, indi-
cating that the observed aberrant profile is not
strain-specific, but is a function of the mutant IF1
allele.
Fig. 6. A model of possible mechanism of suppression of IF1R69 mutant by 23S processing stem mutations. (A) Effect of the mutant
IF1R69L on subunit association in the cold. The forward reaction of subunit association ⁄ dissociation is favored (bold forward arrow). (B) Out-
come when processing stem mutations interfere with 23S rRNA processing. This results in a decreased cellular pool of properly matured
50S subunits, favoring the reverse reaction of subunit association ⁄ dissociation (bold reverse arrow). III indicates sites of processing by RNa-
se III. X indicates RNase III sites blocked because of processing stem mutations.
Fig. 7. Sucrose gradient profile of ribosomes from MG1655 (IF1wt)
and CVR69L (IF1R69L). For this experiment, cells were lysed and
analyzed on gradients with 10 m
M Mg
2+
. Profiles are representative
of three independent experiments.
J. M. Belotserkovsky et al. Processing stem mutations suppress cold-sensitive IF1
FEBS Journal 278 (2011) 1745–1756 ª 2011 The Authors Journal compilation ª 2011 FEBS 1751
Immature 23S rRNA termini are present in both
the 50S and the 70S fractions
We then investigated whether the observed extended
termini present in the 23S processing stem mutants
were incorporated into the 50S subunits and 70S
translating ribosomes. To this end, we purified rRNA
ing ribosomes, in agreement with other reports [13].
This effect was less apparent in the case of the sup-
pressor plasmid pD3, suggesting that extended 23S
rRNA termini are not fully matured on the translating
ribosome.
Other defects in 50S subunit maturation do not
rescue cold sensitivity of mutant IF1
As we had established that processing defects in 23S
rRNA act as suppressors of a cold-sensitive IF1 mutant,
we reasoned that other similar defects in 50S maturation
as a whole may have the same effect. To check this
possibility, we moved, by P1 transduction, deletions in
genes that have been shown to be involved in 50S
maturation into the cold-sensitive IF1 mutant strains.
Specifically, we focused on the genes deaD, dbpA, and
srmB, encoding 23S rRNA helicases DeaD, DbpA, and
SrmB respectively [21–23]. Deletions in these genes (one
at a time) were introduced, by P1 transduction from
KEIO collection donor strains, into CVR69L as well as
JB69, and checked for cold sensitivity suppression [24].
No such suppression was observed when the con-
structed strains were grown at the nonpermissive tem-
perature of 23 °C. This indicates that the suppressive
effect of processing stem mutants was not a function of
general defects in 50S subunit maturation, but was
specific to processing of 23S rRNA termini.
On the basis of our results, we suggest that the dif-
ference observed in sucrose gradient ribosome profiles
between the IF1 mutant and wild-type strains is attrib-
utable to a relative increase in the proportion of 70S
ity in these double mutants is indirect, resulting from
rRNA maturation defects. According to structural
data, the mature form of the processing stem of 23S
rRNA (helix 1) is not proximal to the subunit interface
of 50S, suggesting that direct contacts between IF1 and
Processing stem mutations suppress cold-sensitive IF1 J. M. Belotserkovsky et al.
1752 FEBS Journal 278 (2011) 1745–1756 ª 2011 The Authors Journal compilation ª 2011 FEBS
helix 1 on the ribosome are unlikely. The notion of
indirect suppression was further supported by the
observation that a lesion in RNase III, the enzyme
responsible for initial cleavage of the processing stem,
also suppresses the IF1 defect. On the other hand, the
effect of the RNase III lesion was different from that
of processing stem mutations with respect to the sup-
pression effect in rich liquid medium. As RNase III has
multiple RNA targets in the cell, it is possible that, in
this case, the suppressor effect is, in fact, not directly
related to the processing of rRNA. However, such
effects cannot explain the mode of suppression of the
23S rRNA processing stem mutants.
On the basis of the sucrose gradient data, we suggest
that the mutant IF1, when shifted to the nonpermissive
temperature, leads to an altered rate of subunit associa-
tion ⁄ dissociation, at the expense of some functional
conformational change, presumably in the 30S subunit.
Several lines of evidence support this. First, it is known
from structural studies that IF1 induces conformational
changes in the 30S subunit [7,25,26]. Second, the partic-
ular R69L alteration in IF1 results in a general increase
in expression of reporter genes [27], while also leading
On the basis of our results, we suggest that the identi-
fied 23S processing stem suppressors act by interfering
with ribosome subunit joining by limiting the pool of
available mature 50S subunits (Fig. 6B). Moreover, as a
similarly large fraction of 50S and 70S ribosomes of one
of the processing stem mutants (pD3) is composed of
immature rRNA, it seems unlikely that there exists an
active system that prevents immature 50S subunits from
entering the translating ribosome pool. Therefore, it is
also unlikely that such immature subunits are preferen-
tially degraded. Instead, assembly of ribosomal proteins
onto immature rRNA could be delayed in these
mutants, thus accounting for an apparent decrease in
the amount of ribosome subunits. Defects that affect
rRNA maturation or subunit association should lead to
a similar suppressor phenotype for the R69L mutant
IF1. On the other hand, we found that general defects in
50S subunit maturation, when deletions in known 23S
helicases were introduced into the IF1 mutant, did not
rescue the cold sensitivity. In addition, one would expect
there to be many more potential targets for suppressor
mutations in the 23S structural gene that may interfere
with some step in 23S maturation, 50S assembly, and
subsequent subunit joining, besides those that affect the
23S processing stem. After an extensive selection, we
were not able to find any such suppressor mutations in
the structural part of 23S rRNA. We have, however,
isolated other suppressor mutations that map to the 16S
rRNA structural gene. These were found in helices 18,
20, 32, 34 and 41 in 16S rRNA. Preliminary data indi-
leucine substitution at position 69, by P1 transduction [17].
This strain was then used as a donor for subsequent trans-
fer of the mutant IF1 allele into SQZ10 to generate JB69.
Plasmid pKK3535 [35], containing the rrnB of E. coli and
an Amp resistance marker, was used to replace a resident
plasmid, pCsacB-KmR. PCR-based site-directed mutagene-
sis was used to introduce mutations into pKK3535.
A deletion was introduced into the gene rnc, encoding the
RNase III, with pKO3::Drnc [36]. As a result, only 15 N-ter-
minal and 38 C-terminal amino acids remained in the ORF.
The deletion fragment was constructed according to [37],
with the following primers: rnc5¢O NotI, GTCGGATC
CGCGGATCAGGTGGGGATGTATTA; rnc5¢I comp,
GGCAGTGGATGATGGGGTTCATGCGATACC; rnc3¢O
SalI, TGCGTCGACATTTGCCGCAATAGTGTCAACA;
and rnc3¢I comp, TGAACCCCATCATCCACTGCCAG
GTCAGCG. The deletion was constructed in CVR69L and
JB69 to generate CVR69LDrnc and JB69Drnc, respectively
(Table 1). A pTrc99A vector was used for cloning and over-
expression of era, encoding the GTPase Era. The primers
used were as follows: era_F_NcoI, CGACCATGGCGAAC
AGGCGTTGAAAAAAC; and era_R_SalI, CGAGTCGA
CAGCCTTCCATCGGAGTTACT. The resulting vector
was termed pTrc99a::era. Protein overexpression was
assayed by SDS ⁄ PAGE.
Selection of second-site rRNA suppressors of
cold-sensitive IF1
A direct selection procedure was used to isolate mutations in
rRNA that suppress the cold-sensitive phenotype of JB69.
Briefly, the cold-sensitive R69L mutant [17] of IF1 provided
0.7. Total RNA was isolated from 5-mL cultures
using the RNeasy Mini kit (Qiagen, Hilden, Germany).
Primer extension
Primer extension analysis was used to analyze the 5¢-end of
23S rRNA, with the primer extension system avian
myoblastosis virus reverse transcriptase (Promega, Madi-
son, WI, USA). Probe MRA141 (CCTTCATCGCCTCT-
GACTGCC) was labeled with [
32
P]ATP[cP] and used as a
template for the 5¢-terminus of 23S rRNA. The products of
the primer extension reaction were separated on 6% or 8%
acrylamide 8M urea sequencing gels. The gels were dried
and visualized by phosphor imaging.
Ribosome preparation and sucrose gradient
A 500-mL culture was grown in 2· LB to log phase
(D
590 nm
0.5–0.7) at 37 °C, or grown at 37 °Cto
Table 1. Bacterial strains and plasmids used in this study.
Pertinent
feature(s)
Reference
or source
Plasmids
pKK3535 rrnB, Amp, pBR322-derived [35]
pD1 pKK3535 but suppressor
of infA R69L
This work
pD3 pKK3535 but suppressor
590 nm
0.2, rapidly cooled to 23 °C in a water bath, and
then grown at 23 °C to log phase. Cells were chilled, and
harvested by centrifugation at 4000 g for 15 min. The cells
were destroyed by energetic rubbing, using Al
2
O
3
mixed
with the cells at a ratio of 1: 1 (w ⁄ w). Cell lysis was carried
out by adding 1.5 volumes of buffer A [20 mm Hepes,
10 mm Mg(OAc)
2
, 100 mm NH
4
Cl, 4 mm b-mercaptoetha-
nol, pH 7.3]. The suspension of the destroyed cells was
spun down twice to get rid of the cell debris. Three hun-
dred picomoles of material was loaded onto a 20–40%
sucrose gradient in buffer A, and centrifuged at
25 000 r.p.m. for 19 h in an SW41Ti rotor (Beckman Coul-
ter, Brea, CA, USA). Ribosome profiles were analyzed on
an ISCO gradient fractionator connected to a UV absor-
bance detector (Teledyne Isco, Lincoln, NE, USA). Peaks
were quantified with fityk software (http://www.
unipress.waw.pl/~wojdyr/fityk/). Fractions corresponding to
ribosomal subunits were collected, and rRNA was extracted
with TRIzol reagent (Invitrogen, Carlsbad, CA, USA).
Acknowledgements
We are grateful to SIDA (SWE-2006-509), the Swedish
to the 30S ribosomal subunit. Science 291, 498–501.
8 Hatzopoulos GN & Mueller-Dieckmann J (2010) Struc-
ture of translation initiation factor 1 from Mycobacte-
rium tuberculosis and inferred binding to the 30S
ribosomal subunit. FEBS Lett 584, 1011–1015.
9 Croitoru V, Semrad K, Prenninger S, Rajkowitsch L,
Vejen M, Laursen BS, Sperling-Petersen HU & Isaksson
LA (2006) RNA chaperone activity of translation initia-
tion factor IF1. Biochimie 88, 1875–1882.
10 Phadtare S, Kazakov T, Bubunenko M, Court DL,
Pestova T & Severinov K (2007) Transcription antiter-
mination by translation initiation factor IF1. J Bacteriol
189, 4087–4093.
11 Surkov S, Nilsson H, Rasmussen LC, Sperling-Petersen
HU & Isaksson LA (2010) Translation initiation region
dependency of translation initiation in Escherichia coli
by IF1 and kasugamycin. FEBS J 277, 2428–2439.
12 Milon P, Konevega AL, Gualerzi CO & Rodnina MV
(2008) Kinetic checkpoint at a late step in translation
initiation. Mol Cell 30, 712–720.
13 Kaczanowska M & Ryden-Aulin M (2007) Ribosome
biogenesis and the translation process in Escherichia
coli. Microbiol Mol Biol Rev 71, 477–494.
14 Young RA & Steitz JA (1978) Complementary
sequences 1700 nucleotides apart form a ribonucle-
ase III cleavage site in Escherichia coli ribosomal pre-
cursor RNA. Proc Natl Acad Sci USA 75, 3593–3597.
15 Bram RJ, Young RA & Steitz JA (1980) The ribonucle-
ase III site flanking 23S sequences in the 30S ribosomal
precursor RNA of E. coli. Cell 19, 393–401.
(2003) The DEAD-box RNA helicase SrmB is involved
in the assembly of 50S ribosomal subunits in Escherichi-
a coli. Mol Microbiol 48, 1253–1265.
24 Baba T, Ara T, Hasegawa M, Takai Y, Okumura Y,
Baba M, Datsenko KA, Tomita M, Wanner BL &
Mori H (2006) Construction of Escherichia coli K-12
in-frame, single-gene knockout mutants: the Keio col-
lection. Mol Syst Biol 2, 2006 0008.
25 Qin D & Fredrick K (2009) Control of translation initi-
ation involves a factor-induced rearrangement of
helix 44 of 16S ribosomal RNA. Mol Microbiol 71,
1239–1249.
26 Simonetti A, Marzi S, Myasnikov AG, Fabbretti A,
Yusupov M, Gualerzi CO & Klaholz BP (2008) Struc-
ture of the 30S translation initiation complex. Nature
455, 416–420.
27 Croitoru VV, Bucheli-Witschel M & Isaksson LA
(2005) In vivo involvement of mutated initiation factor
IF1 in gene expression control at the translational level.
FEBS Lett 579, 995–1000.
28 Grunberg-Manago M, Dessen P, Pantaloni D, Godef-
roy-Colburn T, Wolfe AD & Dondon J (1975) Light-
scattering studies showing the effect of initiation factors
on the reversible dissociation of Escherichia coli ribo-
somes. J Mol Biol 94, 461–478.
29 Giangrossi M, Brandi A, Giuliodori AM, Gualerzi CO
& Pon CL (2007) Cold-shock-induced de novo tran-
scription and translation of infA and role of IF1 during
cold adaptation. Mol Microbiol 64, 807–821.
30 Giuliodori AM, Brandi A, Gualerzi CO & Pon CL
type template in site-directed mutagenesis. Biotechnol
Lett 29, 925–930.
38 Bachmann BJ (1987) Derivations and genotypes of
some mutant derivatives of Escherichia coli K-12. In
Escherichia coli and Salmonella typhimurium: Cellular
and Molecular Biology (Neidhardt FC ed), pp. 1190–
1219. ASM Press, Washington, DC.
39 Singer M, Baker TA, Schnitzler G, Deischel SM, Goel
M, Dove W, Jaacks KJ, Grossman AD, Erickson JW &
Gross CA (1989) A collection of strains containing
genetically linked alternating antibiotic resistance
elements for genetic mapping of Escherichia coli.
Microbiol Rev 53, 1–24.
40 Woodcock DM, Crowther PJ, Doherty J, Jefferson S,
DeCruz E, Noyer-Weidner M, Smith SS, Michael MZ
& Graham MW (1989) Quantitative evaluation of
Escherichia coli host strains for tolerance to cytosine
methylation in plasmid and phage recombinants.
Nucleic Acids Res 17, 3469–3478.
Processing stem mutations suppress cold-sensitive IF1 J. M. Belotserkovsky et al.
1756 FEBS Journal 278 (2011) 1745–1756 ª 2011 The Authors Journal compilation ª 2011 FEBS