Functional dissection of Escherichia coli
phosphotransacetylase structural domains and analysis
of key compounds involved in activity regulation
Valeria Alina Campos-Bermudez, Federico Pablo Bologna, Carlos Santiago Andreo and
Marı
´
a Fabiana Drincovich
Centro de Estudios Fotosinte
´
ticos y Bioquı
´
micos (CEFOBI), Universidad Nacional de Rosario, Argentina
Introduction
The successful adaptation of Escherichia coli to nutri-
tional changes depends primarily on metabolic
switches from programs that allow rapid growth on
abundant nutrients to others that permit survival in
their absence. One important switch, called ‘the acetate
switch’, involves the transition from the production to
the utilization of acetate from the medium [1]. During
exponential growth on rich medium, E. coli cells
excrete acetate into the environment as a way, among
other reasons, to recycle CoA and regenerate NAD
+
,
Keywords
acetyl-phosphate; activity regulation;
Escherichia coli; phosphotransacetylase;
protein domain
Correspondence
M. F. Drincovich, Suipacha 531, 2000

CoA synthetase and Pta, indicating that, although not regulated by
metabolites, the Pta C-terminal domain is active in vivo.
Abbreviations
AckA, acetate kinase; Acs, acetyl-CoA synthetase; CDD, Conserved Domain Database; IPTG, isopropyl thio-b-
D-galactoside;
PEP, phosphoenolpyruvate; Pta, phosphotransacetylase.
FEBS Journal 277 (2010) 1957–1966 ª 2010 The Authors Journal compilation ª 2010 FEBS 1957
producing ATP [1]. On the other hand, during the
transition to the stationary growth phase, the machin-
ery responsible for acetate assimilation is activated,
and the cells begin to utilize acetate instead of excret-
ing it.
Acetate production and utilization are catalyzed by
different metabolic pathways in E. coli. Whereas ace-
tate utilization depends primary on acetyl-CoA synthe-
tase (Acs; EC 6.2.1.1), acetate production is catalyzed
by two enzymes: acetate kinase (AckA; EC 2.7.2.1)
and phosphotransacetylase (Pta; EC 2.3.1.8) (Fig. 1A).
Acs is the high-affinity system for acetyl-CoA synthe-
sis, and the enzyme catalyzes an irreversible pathway,
owing to intracellular pyrophosphatases that remove
pyrophosphate (Fig. 1) [2]. However, the Pta–AckA
pathway is reversible, acetyl phosphate being an inter-
mediate of this pathway (Fig. 1A). On the other hand,
the reversible Pta–AckA pathway can also assimilate
acetate [3], but only at high concentrations of this
compound.
Two classes of Ptas can be found among micro-
organisms: PtaIs, which are nearly 350 amino acids
in length; and PtaIIs, which are twice as long as

indicate that, although the substrate-binding site is
located in the C-terminal domain, the E. coli Pta
N-terminal domain is involved in stabilization of the
hexameric native structure, in expression of the max-
imum catalytic activity, and in allosteric regulation
by NADH, ATP, pyruvate, and phosphoenolpyruvate
(PEP).
Acetyl-CoA
Acetate
Pta
Acetyl-AMPAcetyl-P
Ack
Acs
Acs
P
i
CoA
ADP
ATP
AMP
CoA
PP
i
ATP
2P
i
PPasa
Glucose
PEP
Pyruvate

concentration. (B) Regulation of the forward
and reverse Pta reactions. Pta catalyzes
both the synthesis and degradation of
acetyl-CoA. These two reactions are
differentially regulated by pyruvate and PEP,
which activate acetyl-CoA degradation and
inhibit acetyl-CoA synthesis. Acetyl-P, acetyl
phosphate.
Escherichia coli phosphotransacetylase V. A. Campos-Bermudez et al.
1958 FEBS Journal 277 (2010) 1957–1966 ª 2010 The Authors Journal compilation ª 2010 FEBS
Results
Expression and purification of E. coli Pta and
truncated Ptas containing the C-terminal end
By analysis of the protein domain architecture of
E. coli Pta, three conserved domains can be detected
[Conserved Domain Database (CDD)] [11]: the P-loop,
containing NTPase at the N-terminal end
(CDD cl09099; Fig. 2); a DRTGG domain
(CDD pfam07085; Fig. 2); and a domain shared by
the phosphate acetyl ⁄ butaryl transferases (PTA_PTB;
CDD cl00390; Fig. 2) at the C-terminal end. The
members of the P-loop NTPase domain superfamily
(N-terminal domain in E. coli Pta; Fig. 2) are charac-
terized by a conserved nucleotide phosphate-binding
motif, and are involved in diverse cellular functions.
The second domain found in Pta (DRTGG
domain; Fig. 2) has been associated with cystathione-
beta-synthase domain pfam00571 and cobyrinic acid
a,c-diamide synthase domain pfam01656. This domain
has been named according to some of the most

geneity, and the molecular mass of each of them,
assessed by SDS ⁄ PAGE, was in agreement with that
predicted from the protein constructs, i.e. 36 kDa for
Pta-F1, 38 kDa for Pta-F2, and 51 kDa for Pta-F3
(Fig. 3A).
CD spectra of the truncated Ptas
Besides the good expression levels as soluble proteins
of the truncated Ptas, their folding state was evaluated
with CD spectroscopy. Despite the absence of an
important portion of the protein, all of the truncated
Ptas conserved the secondary structure (Fig. 4). In this
respect, CD spectra for Pta-F1, Pta-F2 and Pta-F3
were comparable, but not identical, to the spectrum of
the entire protein (Fig. 4). The differences among the
spectra may be due to the lack of different regions of
the N-terminal end in the truncated Ptas.
Pta-F1
Pta-F2
Pta-F3
100
200 300 400 500 600 700
Pta
PTA_PTB
DRTGG
P-loop NTPase

Fig. 2. Recombinant E. coli Pta and truncated Ptas characterized in
the present work. The ruler indicates the number of amino acids in
each protein. In boxes, the putative conserved domains (CDD pro-
tein classification) in E. coli Pta: P-loop NTPase domain; DRTGG

and Pta-F1 (lane 4). The calculated molecular masses of the purified
proteins are indicated on the left. Molecular mass markers (MM)
were loaded on the right. (B) Coomassie Blue-stained native gel
(5 lg of each protein) of purified recombinant Pta (lane 1), Pta-F1
(lane 2), Pta-F2 (lane 3), and Pta-F3 (lane 4). Native molecular mass
markers (MM) were loaded on the right.
V. A. Campos-Bermudez et al. Escherichia coli phosphotransacetylase
FEBS Journal 277 (2010) 1957–1966 ª 2010 The Authors Journal compilation ª 2010 FEBS 1959
Kinetic characterization of E. coli Pta and
truncated Ptas
The three truncated Ptas displayed Pta catalytic activ-
ity. Thus, the kinetic parameters of the entire Pta and
Pta-F1, Pta-F2 and Pta-F3 were determined using the
conditions in which the in vitro Pta activity was opti-
mal, and compared for both the forward (acetyl-CoA
synthesis) and reverse (acetyl phosphate synthesis)
directions of the Pta reaction (Fig. 1B).
Kinetic parameters for the Pta forward reaction
(acetyl-CoA-forming)
Different kinetic responses of E. coli Pta were observed
for acetyl phosphate and CoA. Whereas the kinetic
response in the case of acetyl phosphate was hyperbolic,
sigmoidal kinetics were observed with respect to CoA,
with a Hill coefficient of 1.7 (Table 1). The enzyme
displayed measurably higher affinity for CoA than for
acetyl phosphate, with a relatively high k
cat
value
(227.6 s
)1

On the other hand, when the truncated Ptas were
analyzed, very low k
cat
values were measured, from
1.5% to 0.1% of the estimated k
cat
for the complete
Pta (Table 1). However, as the case of the acetyl-CoA
synthesis reaction, the affinity for the substrate was
Fig. 4. Comparative CD spectra of E. coli Pta and truncated Ptas.
CD spectra of Pta, Pta-F1 and Pta-F2 were recorded in the far-UV
range (190–260 nm). Five repetitive scans were obtained using
10 l
M each enzyme. The Pta-F3 CD spectrum (not shown) was
practically the same as those obtained for the other truncated Ptas.
Table 1. Kinetic parameters for the forward reaction (acetyl-CoA-forming) and reverse reaction (acetyl phosphate-forming) of E. coli Pta and
truncated Ptas. Kinetic values are given as average ± standard deviation. Each value is averaged over at least two different enzyme prepara-
tions. Ac-P, acetyl phosphate; Ac-CoA, acetyl-CoA; NA, not applicable.
Acetyl-CoA-forming reaction
K
m, Ac-P
(mM) K
m, CoA
(lM) Hill constant for CoA V
max
(UI ⁄ mg) k
cat
(s
)1
)

Escherichia coli phosphotransacetylase V. A. Campos-Bermudez et al.
1960 FEBS Journal 277 (2010) 1957–1966 ª 2010 The Authors Journal compilation ª 2010 FEBS
not significantly modified in the truncated versions in
relation to the complete Pta (Table 1). Moreover, in
some cases (such as Pta-F1), even higher affinity for
acetyl-CoA was observed, with an increase in the Hill
coefficient value (Table 1).
Regulation of E. coli Pta and truncated Pta
activity by metabolic effectors
The effects of several metabolites that acted as meta-
bolic effectors of different Ptas were analyzed for the
recombinant E. coli Pta and the three truncated Ptas
in both the forward and reverse reactions (Fig. 5A).
NADH and ATP substantially inhibited the activ-
ity of E. coli Pta in both directions (Fig. 5A). On the
other hand, pyruvate and PEP displayed differential
behavior, depending on the direction of the Pta reac-
tion analyzed (Fig. 5A). In this way, these com-
pounds acted as activators of the acetyl phosphate-
forming reaction while inhibiting the formation of
acetyl-CoA (Fig. 5A). The activation of the E. coli
Pta acetyl phosphate-forming reaction was analyzed
at different pyruvate and PEP concentrations
(Fig. 5B). The results obtained indicate that the maxi-
mum percentage of activation is reached at concen-
trations higher than 0.5 mm PEP or 10 mm pyruvate
(Fig. 5B).
On the other hand, E. coli Pta acetyl phosphate-
forming activity was measured in the presence of acti-
vators (pyruvate or PEP) and inhibitors (NADH or

addition
NADH Pyr ATP PEP
[PEP] (mM)
100
105
110
115
120
0 0.5 1.0 1.5 2.0
[Pyruvate] (m
M
)
0 5 10 15 20 25 30
Ac-P synthesis activity (%)
Ac-P synthesis activity (%)
100
110
120
130
140
Ac-CoA synthesis activity (%)
0
20
40
60
80
100
120
140
0

for each
enzyme (Table 1). Results are presented as percentage activity in the presence of the effectors relative to the activity measured in the absence
of the metabolites. Assays were performed at least in triplicate, and error bars indicate standard deviations. Similar results to that obtained for
Pta-F3 were obtained for Pta-F2 and Pta-F1. (B) Activation of the acetyl phosphate synthesis activity of E. coli Pta by different concentrations of
pyruvate and PEP. Results are presented as percentage of activity in the presence of PEP or pyruvate relative to the activity measured in the
absence of the metabolites. Assays were performed at least in triplicate, and error bars indicate standard deviations.
V. A. Campos-Bermudez et al. Escherichia coli phosphotransacetylase
FEBS Journal 277 (2010) 1957–1966 ª 2010 The Authors Journal compilation ª 2010 FEBS 1961
Oligomeric state of Pta and the truncated Ptas
The native oligomeric state of recombinant E. coli Pta
was analyzed by size exclusion chromatography. With
this technique, a native molecular mass of
484 ± 5 kDa was obtained, indicating that E. coli Pta
assembles as a hexamer (77 kDa per subunit; Fig. 3A).
Native electrophoresis of recombinant E. coli Pta was
also performed (Fig. 3B). In this case, the estimated
molecular mass obtained (nearly 475 kDa) was similar
to that obtained by size exclusion chromatography,
validating the use of this technique for estimating the
native assembly of this protein.
On the other hand, in order to evaluate the contri-
bution of the N-terminal end to the formation of the
final oligomeric state of Pta, the native conformational
state of the truncated polypeptides was analyzed. By
size exclusion chromatography, several different pro-
tein peaks were obtained (not shown), indicating that
Pta-F1, Pta-F2 and Pta-F3 displayed different aggre-
gates, ranging from dimers to hexamers, in similar pro-
portions. The results with native electrophoresis were
same as those obtained by exclusion chromatography,

forming reaction and as negative effectors of the
opposite reaction (Fig. 5). Thus, these compounds
highly favor E. coli Pta acetyl phosphate synthesis
activity. This differential Pta activity regulation by
pyruvate and PEP may be important in vivo, as this
enzyme is involved in balancing pyruvate flux when
E. coli grows on rich medium, by opting for acetate
excretion [13]. Thus, high levels of pyruvate and ⁄ or PEP
activate acetate excretion by favoring the Pta acetyl
phosphate reaction (Fig. 1B). On the other hand, E. coli
Pta was negatively modified by NADH and ATP in both
directions of the reaction, which is in accord with the
fact that when the tricarboxylic acid cycle is operating,
acetate excretion by the Pta–AckA pathway is reduced.
However, in the presence of pyruvate or PEP, the
inhibitory effect of NADH or ATP is partially or totally
reversed (Fig. 5A), indicating the relevance of these
compounds in the activation of acetate excretion
(Fig. 1B).
E. coli Pta K
m
values for the substrates (Table 1)
were compared with the absolute metabolite concentra-
tions in E. coli growing on glucose or acetate [14], as
these concentrations are critical for understanding the
in vivo rate of the Pta reaction. In this regard, the
acetyl-CoA concentration in E. coli is far higher than
the estimated Pta K
m
, indicating that Pta is operating

maximum rate for acetate assimilation (Fig. 1B).
By size exclusion chromatography, E. coli Pta was
found to assemble as a hexamer. Practically the same
native molecular mass was estimated for S. enterica
Pta [5]. In this way, the positive cooperative effect
found in CoA and acetyl-CoA binding (Table 1) would
be due to interactions among the active sites in the
oligomeric Pta.
Recently, a detailed biochemical characterization of
S. enterica Pta was performed [5]. When the kinetic
performance of the enzymes is compared, although
the maximum activities in both directions of the
reaction are in the same order of magnitude, there is
a notably higher affinity of E. coli Pta for both CoA
and acetyl-CoA. Thus, E. coli Pta K
m
values for CoA
and acetyl-CoA are 2.4-fold and 7.3-fold lower than
the K
m
values for S. enterica Pta, respectively
(Table 1 [5]). Thus, although the two proteins share
95% identity, specific changes in amino acids may be
involved in the affinity differences. With regard to
metabolic regulation, acetyl phosphate synthesis by
S. enterica Pta is also activated by pyruvate and
inhibited by NADH [5], as in E. coli (Fig. 5),
although these compounds were not tested in the
acetyl-CoA synthesis direction.
Pta-F3 is able to complement E. coli acs pta

(Table 1). However, they displayed notably lower maxi-
mum activity (Table 1). Consequently, although the
binding sites for the substrates are conserved in the trun-
cated Ptas and are thus located in the PTA_PTB
domain, residues from the N-terminal domain, specifi-
cally from the P-loop NTPase domain (Fig. 2), are
needed for maximal catalytic activity, participating
either directly in the catalytic mechanism, or indirectly
in the conformation of the catalytic site.
The oligomeric state of the truncated Ptas was eval-
uated by gel filtration chromatography and native gel
electrophoresis (Fig. 3B). The results indicate that the
N-terminal domain is important for stabilization of
hexameric native Pta, as none of the truncated Ptas
was able to assemble as a hexamer (Fig. 3B). Specifi-
cally, the P-loop NTPase domain is important for
native hexameric stabilization, as Pta-F3 did not dis-
play a stable native conformation (Figs 2 and 3B).
Therefore, another possible explanation for the low
activity displayed by the truncated Ptas is that the for-
mation of a hexameric protein is critical for maximal
catalytic activity.
On the other hand, the activity of the truncated Ptas
was not regulated by any of the metabolites that were
able to modify the activity of the complete Pta
(Fig. 5A). Thus, the N-terminal domain, specifically
the P-loop NTPase domain (Fig. 1), is involved in the
metabolic regulation of E. coli Pta. Two explanations
may account for this result: the first is that the binding
site of the effectors is located at the N-terminal end of

E. coli DH5a was used as a general cloning host. E. coli
K-12 AG1, containing the plasmid pCA24N–Pta (ASKA
clone JW2294), was obtained from the ASKA library [15].
Strains were routinely cultured aerobically in LB broth with
appropriate antibiotics. Alternatively, the different E. coli
strains were grown on minimal medium M9 containing
15 mm acetate. For expression and purification, different
strains, depending on the expression vector, were used:
E. coli K-12 AG1 for pCA24N–Pta; E. coli BL21(DE3) for
pET28–F1 and pET28–F2; and E. coli M15 for pQE30–F3.
Construction of the E. coli acs pta deletion strain
The E. coli acs pta deletion strain (FB22) was constructed
using the pta single-gene deletion mutant JW2294, obtained
from the NIG Collection [16], as recipient strain. The acs
deletion in JW2294 was performed as described by
Datsenko and Wanner [17]. The cat
+
cassette in plasmid
pKD3 was amplified using primers with 60 bp of perfect
identity for the 5¢-end and 3¢-end of acs: delacs P1
(forward), 5¢-GAGAACAAAAGCATGAGCCAAATTCA
CAAACACACCA TTGTG TAGGC TGGAGCT GCTTC G-3¢;
and delacs P2 (reverse), 5¢-GGCAATTGTGGGTTAC
GATGGCATCGCGATAGCCTGCTTCATATGAATATC
CTCCTTA-3¢. The presence of the acs pta deletion was
confirmed by sequencing. The mutated acs pta E. coli
strain, called FB22, was transformed with plasmids
pCA24N–Pta or pQE–F3 for complementation analysis.
Induction of the introduced plasmids was performed by
the addition of 0.5 mm isopropyl thio-b-d-galactoside

and 1 min 30 s at 72 °C; and one cycle of 5 min at 72 °C.
The amplified PCR fragments were cloned using pGEM
T-Easy (Promega), and digested with the corresponding
restriction enzymes. The resulting fragments were purified
from a 1% agarose gel using a Qiaex band purification kit
(Qiagen, Hilden, Germany), and cloned between the
corresponding restriction sites in pET28 (Novagen, EMD
Chemicals Inc., Gibbstown, NJ, USA) for Pta-F1 and Pta-
F2, or in pQE30 (Qiagen) for Pta-F3. The plasmids were
finally introduced into E. coli DH5a cells by electropora-
tion using a Bio-Rad apparatus, following the manufac-
turer’s recommendations.
Protein expression and purification
E. coli Pta and Pta-F1, Pta-F2 and Pta-F3 were produced
in E. coli K-12 AG1, E. coli BL21(DE3) or E. coli M15
containing the corresponding expression vectors (p–Pta,
pET28–F1, pET28–F2, and pQE30–F3). The systems used
yield high-level expression of the recombinant proteins
fused to a His-tag sequence at the N-terminal end codified
by the pET and pQE vectors used. All chromatographic
Escherichia coli phosphotransacetylase V. A. Campos-Bermudez et al.
1964 FEBS Journal 277 (2010) 1957–1966 ª 2010 The Authors Journal compilation ª 2010 FEBS
steps were performed on an A
¨
KTA purifier (GE Health-
care, Uppsala, Sweden).
Optimal induction conditions for the expression of each
protein were achieved using IPTG as an induction agent,
and different induction temperatures were tried. Optimal
overexpression of the fusion proteins was achieved by induc-

monitoring the thioester bond formation of acetyl-CoA at
233 nm (e
233 nm
= 5.55 mm
)1
Æcm
)1
). The assay mixture
contained 50 mm Tris ⁄ HCl (pH 8.0), 20 mm KCl, 10 mm
lithium acetyl phosphate, 0.2 mm lithium-CoA, and 2 mm
dithiothreitol.
The reverse Pta activity (Fig. 1B) was monitored by mea-
suring the phosphate-dependent CoA release from acetyl-
CoA with Ellman’s thiol reagent, 5¢,5-dithiobis(2-nitroben-
zoic acid), as the formation of thiophenolate anion at
412 nm (e
412 nm
= 13 600 m
)1
Æcm
)1
). The assay mixture
contained 50 mm Tris ⁄ HCl (pH 8.0), 20 mm KCl, 0.1 mm
5¢,5-dithiobis(2-nitrobenzoic acid), 0.1 mm acetyl-CoA, and
5mm KH
2
PO
4
.
Steady-state kinetic parameters were determined for both

USA). The column was equilibrated with 100 mm phos-
phate buffer at pH 7.4, and calibrated using molecular
mass standards (Sigma-Aldrich, St Louis, MO, USA). The
sample and the standards were applied separately in a final
volume of 50 lL at a constant flow rate of 1 mLÆmin
)1
. All
chromatographic steps were performed on an A
¨
KTA
purifier (GE Healthcare).
CD
CD spectra of purified Pta variants were obtained with a
Jasco J-810 spectropolarimeter, using a 0.2 cm pathlength
cell and averaging five repetitive scans between 260 nm and
200 nm. Typically, 10 lm protein in 10 mm Tris (pH 8.0)
was used for each assay.
Acknowledgements
This work was funded by grants from CONICET and
Agencia Nacional de Promocio
´
n Cientı
´
fica y Tecnolo
´
g-
ica. M. F. Drincovich and C. S. Andreo are mem-
bers of the Researcher Career of CONICET, and
V. A. Campos-Bermu´ dez and F. P. Bologna are
fellows of the same institution.

S-H (2004) Crystal structure of a phosphotransacetylase
from Streptococcus pyogenes. Proteins 55, 479–481.
8 Xu QS, Jancarik J, Lou Y, Kusnetsova K, Yakunin
AF, Yokota H, Adams P, Kim R & Kim S-H (2005)
Crystal structure of a phosphotransacetylase from Bacil-
lus subtilis and its complex with acetyl phosphate.
J. Struct. Funct. Genomics 6, 269–279.
9 Suzuki T (1969) Phosphotransacetylase of Escherichia
coli B, activation by pyruvate and inhibition by NADH
and certain nucleotides. Biochim Biophys Acta 191, 559–
569.
10 Klein AH, Shulla A, Reimann SA, Keating DH &
Wolfe AJ (2007) The intracellular concentration of ace-
tyl phosphate in Escherichia coli is sufficient for direct
phosphorylation of two-component response regulators.
J Bacteriol 189, 5574–5581.
11 Marchler-Bauer A, Anderson JB, Chitsaz F, Derbyshire
MK, DeWeese-Scott C, Fong JH, Geer LY, Geer RC,
Gonzales NR, Gwadz M et al. (2009) CDD: specific
functional annotation with the Conserved Domain
Database. Nucleic Acids Res 37(D), 205–210.
12 Kakuda H, Hosono K, Shiroishi K & Ichihara S (1994)
Identification and characterization of the ackA (acetate
kinase A)–pta (phosphotransacetylase) operon and com-
plementation analysis of acetate utilization by an ackA–
pta deletion mutant of Escherichia coli. J Biochem 116,
916–922.
13 Chang DE, Shin S, Rhee JS & Pan JG (1999) Acetate
metabolim in a pta mutant of Escherichia coli W3110:
importance of maintaining acetyl coenzyme A flux for

Nature 227, 680–685.
21 Davis BJ (1964) Disc electrophoresis. II. Method and
application to human serum proteins. Ann NY Acad Sci
121, 404–427.
Escherichia coli phosphotransacetylase V. A. Campos-Bermudez et al.
1966 FEBS Journal 277 (2010) 1957–1966 ª 2010 The Authors Journal compilation ª 2010 FEBS