Cardiac ankyrin repeat protein is a marker of skeletal
muscle pathological remodelling
Lydie Laure
1
, Laurence Suel
1
, Carinne Roudaut
1
, Nathalie Bourg
1
, Ahmed Ouali
2
, Marc Bartoli
1
,
Isabelle Richard
1
and Nathalie Danie
`
le
1
1Ge
´
ne
´
thon-CNRS FRE3087, Evry, France
2 INRA de Theix, Saint Gene
`
s Champanelle, France
Muscle atrophy can result from disuse of the organ or
be associated with ageing or severe systemic conditions
protein metabolism was investigated in experimental atrophy induced by
transient or definitive denervation, as well as in four animal models of
muscular dystrophies (deficient for calpain 3, dysferlin, a-sarcoglycan and
dystrophin, respectively). The results showed that: (a) the components of
the ubiquitin–proteasome pathway are upregulated during the very early
phases of atrophy but do not greatly increase in the muscular dystrophy
models; (b) forkhead box protein O1 mRNA expression is augmented in
the muscles of a limb girdle muscular dystrophy 2A murine model; and (c)
the expression of cardiac ankyrin repeat protein (CARP), a regulator of
transcription factors, appears to be persistently upregulated in every condi-
tion, suggesting that CARP could be a hub protein participating in com-
mon pathological molecular pathway(s). Interestingly, the mRNA level of
a cell cycle inhibitor known to be upregulated by CARP in other tissues,
p21
WAF1/CIP1
, is consistently increased whenever CARP is upregulated.
CARP overexpression in muscle fibres fails to affect their calibre, indicating
that CARP per se cannot initiate atrophy. However, a switch towards fast-
twitch fibres is observed, suggesting that CARP plays a role in skeletal
muscle plasticity. The observation that p21
WAF1/CIP1
is upregulated, put in
perspective with the effects of CARP on the fibre type, fits well with the
idea that the mechanisms at stake might be required to oppose muscle
remodelling in skeletal muscle.
Abbreviations
AAV2/1, adeno-associated virus 2/1; Ankrd2, ankyrin repeat domain-containing protein 2; CARP, cardiac ankyrin repeat protein; DAPI,
4¢,6-diamidino-2-phenylindole; DMD, Duchenne muscular dystrophy; EDL, extensorum digitorum longus; FoxO, forkhead box protein O;
FP, fluorescent protein; LGMD, limb girdle muscular dystrophy; MAFbx, muscle atrophy F-box protein; MD, muscular dystrophy; MLC-2v,
myosin light chain 2v; MLC-f, myosin light chain, fast; MuRF1, muscle RING finger protein 1; NF, neurofilament protein; NF-jB, nuclear
atrogin-1) and muscle RING finger protein 1 (MuRF1;
also named TRIM63), are upregulated in many skele-
tal muscle-wasting conditions [5]. During atrophy,
expression of MAFbx and MurF1 is stimulated by the
forkhead box protein O (FoxO) family of transcription
factors, through inhibition of the Akt pathway [6,7].
In addition, it was also shown that transcriptional
stimulation of MuRF1 is under the control of the
nuclear factor-jB (NF-jB) pathway [8].
Even though the literature largely explores the con-
vergent role of the UPS components in atrophy, mus-
cle wasting is a complex mechanism in which specific,
although poorly understood, pathways could play a
role. In particular, cardiac ankyrin repeat protein
(CARP) was suggested to be involved in these pro-
cesses. CARP, together with ankyrin repeat domain-
containing protein 2 (Ankrd2) and diabetes-related
ankyrin repeat protein, forms a family of transcription
regulators known as muscle ankyrin repeat proteins.
These three isoforms share in their C-terminal region a
minimal structure composed of several ankryrin-like
domains possibly involved in protein–protein inter-
action, PEST motifs characteristics of rapidly degraded
protein, and a putative nuclear localization signal.
CARP is expressed in both cardiac and skeletal mus-
cles, and was reported to be either upregulated [9] or
downregulated [10,11], depending on the atrophic situ-
ation considered, and upregulated in hypertrophic con-
ditions in heart [12–17] and in skeletal muscle [18–21].
From the functional point of view, in heart cells,
atically increases. CARP overexpression in muscle
fibres fails to induce an atrophic phenotype, indicating
that CARP per se cannot initiate the phenomenon.
Nonetheless, the switch towards fast-twitch fibres
observed in this situation, together with the observa-
tion that the p21
WAF1/CIP1
expression pattern seems to
reflect CARP level, suggests that CARP might play a
role in muscle plasticity.
Results
The proteasome pathway components are
only transiently upregulated, whereas increased
CARP expression is maintained throughout
denervation-induced-atrophy
The expression of several factors possibly involved in
atrophy was investigated by the evaluation of their
mRNA level by quantitative RT-PCR (qRT-PCR) in
conditions leading to transitory or definitive atrophy.
The genes studied were those encoding: (a) two tran-
scription factors involved in the control of muscle
mass: NF-jB-p65 and FoxO1; (b) several components
Cardiac ankyrin repeat protein in muscle plasticity L. Laure et al.
670 FEBS Journal 276 (2009) 669–684 ª 2008 The Authors Journal compilation ª 2008 FEBS
of the UPS – ubiquitin (Ub), E2-14 kDa, two E3
ubiquitin ligases, MuRF1 and MAFbx, and the C2,
C8 and C9 subunits of the proteasome; and (c) CARP,
a transcriptional regulator associated with perturbation
of muscle mass. Transient or chronic denervation of
the posterior limb was induced and the mRNA levels
*
0
50
100
150
200
250
300
T0 T3 T9 T14 T21 D0 D3 D9 D14D21
% of control
FoxO1
0
50
100
150
200
250
300
0
50
100
150
200
250
300
50
100
150
200
250
150
T0 T3 T9 T14 T21 D0 D3 D9 D14D21
% of control
E2
0
50
100
150
0
50
100
150
T0 T3 T9 T14 T21 D0 D3 D9 D14D21T0 T3 T9 T14 T21 D0 D3 D9 D14D21
% of control
**
1
10
100
1000
T0 T3 T9 T14T21 D0 D3 D9 D14D21
% of control
MuRF1
1
10
100
1000
1
10
100
1000
15
20
25
30
35
40
45
50
Day 3 Day 9 Day 14 Day 21
15
20
25
30
35
40
45
50
15
20
25
30
35
40
45
50
Day 3 Day 9 Day 14 Day 21Day 3 Day 9 Day 14 Day 21
Control
Transient
Definitive
TA weight (mg)
T0 T3 T9 T14T21 D0 D3 D9 D14D21
% of control
CARP
1
10
100
1000
10 000
100 000
T0 T3 T9 T14T21 D0 D3 D9 D14D21T0 T3 T9 T14T21 D0 D3 D9 D14D21
% of control
*
**
**
**
**
**
**
0
50
100
150
200
T0 T3 T9 T14 T21 D0 D3 D9 D14D21
% of control
C2
0
50
100
150
*
**
A
B
Fig. 1. Effect of transient or definitive
denervation on muscle weight and gene
expression profiles. Male mice of the
129SvPasIco strain were treated transiently
(T) by crushing or definitively (D) by section
of the sciatic nerve. Samples were taken
from six animals on each date (control, 3, 7,
9, 14 and 21 days after nerve injury). (A)
Weight of TA muscles from control, crushed
and sectioned limbs (n = 6 per time point).
Other muscles of the lower limb, such as
EDL and soleus muscles, present similar
proportional loss of weight. P-values are
shown as *P < 0.05 for significance
between control and each time point, and
as
h
P < 0.05 for significance between tran-
sient and definitive denervation. (B) Each
graph demonstrates the expression level for
a gene of interest (FoxO1, NF-jB-p65, Ub,
E2-14 kDa, C2, C8, C9, MuRF1, MAFbx and
CARP ) as assessed by qRT-PCR in TA
muscles of treated animals (n = 2–6 for
each time point). Results are expressed as
percentage of expression level measured in
upregulation was particularly important, as reflected
by the logarithmic scale.
CARP is robustly upregulated in murine MDs,
whereas FoxO1 expression is increased
specifically in C3-null animals
The expression levels of the mRNAs measured in
denervation conditions were also compared by qRT-
PCR in several models of MD: a natural model of
dysferlin deficiency [26], which we backcrossed on a
C57BL/6 background and renamed B6.A/J-dysf
prmd
(model for LGMD2B), and three engineered models
deficient in either dystrophin (mdx
4Cv
[27]), calpain 3
(C3-null; unpublished), or a-sarcoglycan (Sgca-null
[28]), models of DMD, LGMD2A and LGMD2D,
respectively. Every strain was used at an age where the
symptoms of the disease are detectable (4 months of
age for all models except C3-null mice, which were
evaluated at 7 months of age) and was compared to its
respective control breed. The levels of mRNA expres-
sion were measured in five muscles [quadriceps,
extensorum digitorum longus (EDL), TA, soleus and
psoas], chosen in order to reflect the muscle impair-
ment specificity – which varies between models – and
the type of fibres composing the muscle (see Experi-
mental procedures).
The results of qRT-PCR showed that the level of
NF-jB-p65 was slightly increased in specific muscles of
ized by a similar pathogenesis and caused by a defect
in one of the components of the dystrophin-associated
glycoprotein complex.
CARP is expressed at the protein level in
myofibres of denervation-induced atrophy
models and in mononucleated cells of highly
regenerative MD animals
Among all the genes whose expression was investi-
gated in the different models of muscle disorder, we
demonstrated that the CARP gene was the only one
whose expression systematically increased, which is
consistent with CARP’s role as a hub protein partici-
pating in common pathological molecular pathway(s).
CARP protein expression was hence measured by
western blot in conditions of denervation-induced
atrophy and in murine models of MD (Fig. 3). Inter-
estingly, we observed that the protein was detected
by western blot provided that the mRNA level
reached 60-fold over the basal condition. This ele-
ment probably accounts for the inability to detect
CARP in many conditions in which its mRNA
upregulation is indeed important, although not
important enough. The protein was therefore
detected from day 3 in both denervation conditions,
remaining high until day 21 when the sciatic nerve
was sectioned, but dropping to undetectable levels
when reinnervation occurred during transient dener-
vation (Fig. 3A, upper left panel). As regards the
murine models of dystrophies, CARP protein was
Cardiac ankyrin repeat protein in muscle plasticity L. Laure et al.
Control
Sgca-null
Day3 after denervation
Sgca-nullControl
CARP Pax7 Merge
255.0
0.0
1440.0 pixels
1560.0 pixels
1440.0 pixels
1560.0 pixels
2550
0.0
A
B
C
D
E
T21 D3 D9 D14 D21
Sgca-null
C57BL/6
mdx
4cn
mdx
4cn
mdx
4cn
50 µm 50 µm
50 µm
Cardiac ankyrin repeat protein in muscle plasticity L. Laure et al.
atrophy models
In an attempt to dissect the molecular mechanisms
activated downstream of the CARP gene, the gene
expression of three relevant target genes chosen on
account of CARP targets in cardiac and vascular tis-
sues was measured by qRT-PCR in both denervation
and MD models: the slow isoform of myosin light
chain MLC-2v [23], its paralogous gene in skeletal
muscle fast fibres, myosin light chain, fast (MLC-f),
and the cell cycle inhibitor p21
WAF1/CIP1
[24]. Although
it was previously reported to be expressed at low levels
in skeletal muscle [29], MLC-2v gene expression
remained undetectable in our conditions (data not
shown). Whereas MLC-f expression was inversely
correlated with CARP level in denervated animals, its
level was generally unaffected, or even slightly
increased, in muscles of MD models (data not shown).
As neither MLC-2v nor MLC-f expression were corre-
lated consistently with CARP level, neither of these
proteins seems to be involved in the CARP signalling
pathway in skeletal muscle. In contrast, in both dener-
vation and MD models, p21
WAF1/CIP1
gene expression
paralleled the CARP profile, i.e. increased when muscle
degeneration occurred, and progressively decreased
back to control level during the reinnervation phase of
transient denervation (Fig. 4). It is worth mentioning
models but C3-null) or the deltoid muscle (C3-null mice) of the different MD models (comparison made in each case with the adequate wild-
type strain). We previously verified that the upregulation of the level of CARP transcripts is similar in both deltoid and psoas in the C3-null
strain (five-fold over wild-type control, data not shown). The results show that the upregulation of the expression of CARP protein can be
visualized in the Sgca-null model only. (B) CARP was detected by specific immunostaining (in green) on transverse sections of control
(129svPasIco), denervated (129svPasIco), Sgca-null and mdx
4Cv
muscles. Staining with dystrophin (in red) was used to delimit the fibres. A
view of each muscle taken with a 40· objective is presented, showing the very specific staining observed within clusters of small myofibres.
Scale bars: 30 lm. (C) Surface plots representing the density of pixels from whole muscle sections after immunostaining show that CARP
expression increases after denervation. Original images were processed using
IMAGEJ software (8-bit images, Fire look-up table; http://rsb.
info.nih.gov/ij/). (D) Very intense foci of mononucleated cells are observed in Sgca-null and mdx
4Cv
muscles, but not in control muscles. Scale
bars: 50 lm. (E) Costaining for CARP and Pax7 shows that the cells identified in (D) are positive for Pax7.
L. Laure et al. Cardiac ankyrin repeat protein in muscle plasticity
FEBS Journal 276 (2009) 669–684 ª 2008 The Authors Journal compilation ª 2008 FEBS 675
We next investigated whether any phenotype was
apparent following CARP expression. In these condi-
tions, the TA muscle weight was not affected
(Fig. 5D). The histological appearance of the muscles
was normal (Fig. 5E). Morphometric analyses per-
formed on sliced muscles (Fig. 5F) revealed no differ-
ences in terms of number or mean diameter of fibres
in comparison with the untreated control, although
the slight switch of the curve detected in the presence
of CARP might reflect a tendency to generate bigger
fibres. Muscle sections were negative for terminal
deoxynucleotidyl transferase dUTP nick end labelling
(TUNEL) staining, a marker of apoptosis (data not
has lately been reconsidered, as the inactivation of the
corresponding genes does not seem to induce atrophy
resistance, at least in the conditions tested [34]. In con-
trast to the denervation situation, the mRNA expres-
sion levels of the UPS elements were almost never
increased in the four MDs tested, suggesting that the
UPS is not overly activated in these diseases. Whether
this reflects the slow progression of the diseases with
respect to the atrophy phenomenon or weak involve-
ment of the UPS in the pathogenesis remains to be
determined.
Second, FoxO1 was demonstrated to be specifically
upregulated in every muscle of the C3-null strain.
Besides raising the interesting possibility that FoxO1
could be used as a diagnostic marker for LGMD2A,
our results indicate that FoxO1 expression increases as
a consequence of the absence of calpain 3, either
because of a functional relationship between the two
proteins, or by a specific pathophysiological mecha-
nism unique to calpain 3 deficiency. Regardless of its
cause, this upregulation of FoxO1 is very likely to play
an important role in the atrophy observed in this dis-
ease, as its in vivo overexpression was previously dem-
onstrated to induce reduction of muscle mass [6,35].
However, this phenomenon does not seem to proceed
through MuRF1 and MAFbx, as their expression
levels did not increase in our C3-null strain, but might
p21
WAF1/CIP1
p21
20
40
60
80
100
Control + CARP
**
*
0
5000
10 000
15 000
20 000
25 000
Control CARP
CARP mRNA level
(% of control)
WB CARP
Ponceau red
+ CARPControl
0
100
200
300
400
500
600
700
800
900
ated by western blot. Equivalent amounts of proteins were resolved, and Ponceau red staining was also used to confirm the standardization
of the loading. (D) Weights of injected TA muscles (n = 13) were compared to those of control samples. No significant difference was
observed. (E) Histological analyses of muscles. Frozen sections of injected TA muscles (right panel) stained with haematoxylin–phloxin–sa-
fran show features identical to normal sections (left panel). Scale bars: 20 lm. (F) Morphometric analysis of muscles overexpressing CARP.
The number of fibres and their minimum diameter in injected muscles are not significantly different as compared to the control (n = 4). (G)
Slow fibres were detected using slow myosin immunostaining, and their numbers were determined on three slices of the TA muscle mid-
section. The number of slow fibres is reduced significantly (*P < 0.05) in CARP-expressing muscles as compared to noninjected muscles,
indicating that CARP can influence the fibre type (n = 6).
L. Laure et al. Cardiac ankyrin repeat protein in muscle plasticity
FEBS Journal 276 (2009) 669–684 ª 2008 The Authors Journal compilation ª 2008 FEBS 677
Third, the most striking evidence obtained from our
investigation is that CARP expression appears to be
persistently upregulated in denervation-induced atro-
phy and is also elevated in all the MD models investi-
gated. This last observation adds to the panel of muscle
pathologies already reported to be associated with an
increase in CARP expression: DMD, spinal muscular
atrophy, facio-scapulo-humeral muscular dystrophy,
amyotrophic lateral sclerosis, and peroxisome prolifera-
tor-activated receptor-induced myopathy [41], as well
as the mdx, Swiss Jim Lambert (SJL) and muscular
dystrophy with myositis (MDM) animal models, defi-
cient respectively in dystrophin, dysferlin and titin [42–
48]. Overall, CARP seems to be a general marker of
muscle damage. The reason(s) for CARP upregulation
remain(s) obscure, and whether CARP expression par-
ticipates in or represents an attempt to resist the unre-
lenting muscle degeneration is an important issue.
It is of interest that CARP is the only protein show-
ing a variation of profile between transient and defini-
blasts [49] and terminally differentiated myotubes [50])
as CARP overexpression. First, in the skeletal myo-
genic lineage, p21
WAF1/CIP1
upregulation leads to the
irreversible withdrawal of myoblasts from the cell
cycle, stimulates differentiation, and confers protection
against apoptosis [49]. However, intense regeneration
is still ongoing in both the Sgca-null and mdx
4Cv
mod-
els, which suggests that either p21
WAF1/CIP1
is not
inhibiting the cell cycle or else that the inhibition pro-
cess is not entirely efficient. Second, p21
WAF1/CIP1
has
previously been reported to be upregulated within the
myonuclei of denervated muscles, a location where it
might be required to protect fibres against denerva-
tion-induced apoptosis [50]. Taken as a whole, the
findings in the MD and denervation models studied
herein suggest that the systematic upregulation of
p21
WAF1/CIP1
whenever CARP expression increases
might oppose cell proliferation and/or inhibit apop-
tosis, thus preventing muscle remodelling.
It should also be noted that muscle ankyrin repeat
mediated inhibition of tumour necrosis factor-a [53] or
transforming growth factor-b [54] in the mdx mouse
model greatly improves the muscle histology, it would
be interesting to investigate the role of CARP in these
signalling pathways.
Experimental procedures
Animals
All mice were handled in accordance with the European
guidelines for the humane care and use of experimental
Cardiac ankyrin repeat protein in muscle plasticity L. Laure et al.
678 FEBS Journal 276 (2009) 669–684 ª 2008 The Authors Journal compilation ª 2008 FEBS
animals. The C3-null model corresponds to complete inac-
tivation of calpain 3 expression. Exon 1 of the calpain 3
gene has been targeted by an IRES–LacZ–Lox-PGK–
hygro–lox cassette to allow the expression of the LacZ
transgene and prevent the expression of the calpain 3 gene
from the muscle-specific promoter upstream of exon 1.
The a-sarcoglycan-deficient (Sgca-null) model has been
previously described [28]. The mdx
4Cv
model is an engi-
neered model carrying a missense mutation in exon 53 of
the dystrophin gene [55,56] and was obtained from the
Jackson Laboratory (Ann Harbor, USA). A/J mice, which
have a retrotransposon insertion in intron 4 of the dysfer-
lin gene [26], were backcrossed with C57BL/6 for four
generations and renamed B6.A/J-dysf
prmd
. Control mice
from the 129SvPasIco and C57BL/6 strains were pur-
TA muscles were sampled 1 month after injection, and
directly observed using confocal fluorescence microscopy
(emission wavelength used for data collection: 514 nm) to
allow visualization of YFP fluorescence. Muscles were then
quickly frozen in liquid nitrogen.
Quantitative RT-PCR
Quadriceps, EDL, TA, soleus and psoas muscles were
sampled from four animals aged 4 months for the mdx
4Cv
,
B6.A/J-dysf
prmd
and Sgca-null models and their controls,
and aged 7–8 months for the C3-null model and its con-
trol. Muscles were chosen in order to reflect the muscle
impairment specificity – which varies between models –
and the type of fibres composing the muscle. In the
C3-null model, the quadriceps muscle is unaffected by the
disease, the EDL and TA muscles are weakly affected,
and the soleus and psoas muscles are the most strongly
affected (C. Roudaut & I. Richard, unpublished data). In
the A/J mouse, the first dystrophic signs are seen at
2 months of age, and progress as a function of age. The
quadriceps femoris and triceps brachii muscles are the
most severely affected, whereas the gastrocnemius, soleus
and tibialis anterior muscles show mild histopathology,
even at late stages of the disease [26]. Placing the A/J
mutation on a C57BL/6 background has no effect on the
disease presentation (N. Bourg & I. Richard, unpublished
data). In the Sgca-null and mdx
for amplification are given in Table 1. Each experiment
was performed in duplicate and repeated at least twice.
Construction and production of viral vector
The coding sequence of CARP was obtained by PCR
amplification using mouse cDNA extracted from muscle
of a 129SvTer mouse as a template. The primers used
were 5¢-CACCATGATGGTACTGAGAG-3¢ and 5¢-GAA
TGTAGCTATGCGAGAGTTC-3¢. The PCR product was
first cloned into pcDNA3.1D/V5–His–Topo (Invitrogen),
and then transferred, after enzymatic restriction, into an
AAV-based pSMD2-derived vector [57], where the CARP
L. Laure et al. Cardiac ankyrin repeat protein in muscle plasticity
FEBS Journal 276 (2009) 669–684 ª 2008 The Authors Journal compilation ª 2008 FEBS 679
sequence is placed under the control of a cytomegalovirus
promoter and fused at its 5¢-end with YFP and at its
3¢-end with cyan fluorescent protein. This last construct
is named pAAV.CMV.CARP-FP. The integrity of all
constructs was confirmed by automated sequencing.
AAV2/1 viral preparations were generated by packaging
AAV2-inverted terminal repeat recombinant genomes in
AAV1 capsids using a three-plasmid transfection protocol
as previously described [58]. Recombinant vectors were
purified by using double caesium chloride gradient
ultracentrifugation followed by dialysis against sterile
NaCl/P
i
. After DNA extraction by successive treatments
with DNase I and proteinase K, viral genomes were
quantified by a TaqMan real-time PCR assay using prim-
ers and probes complementary to the inverted terminal
MAFbx F-box only protein 32 (Fbox32) NM_026346 1235mMafBx.F,
CTGGAAGGGCACTGACCATC
1265mMafBx.P, CAACAACCCAGAGAGCTGCTCCGTCTC
1353mMafBx.R, TGTTGTCGTGTGCTGGGATT
MLC-f Myosin light chain, fast BC055869 396mMLCfast.F: TGGAGGAGCTGCTTACCACG
423mMLCfast.P: ACCGATTTTCCCAGGAGGAGATCAAGAA
500mMLCfast.R: TCTTGTAGTCCACGTTGCCG
MLC-2v Myosin light chain, slow NM_010861 381mMLC-2V.F: GAAGGCTGACTATGTCCGGG
403mMLC-2V.P: ATGCTGACCACACAAGCAGAGAGGTTCTC
461mMLC-2V.R: GCTGCGAACATCTGGTCGAT
MuRF1 Tripartite motif-containing 63
(Trim63)
NM_001039048 958mMurf1.F AGGGCCATTGACTTTGGGAC
995mMurf1.P AGGAGGAGTTTACAGAAGAGGAGGCTGATGAG
1047mMurf1.R CTCTGTGGTCACGCCCTCTT
NF-jB-p65 v-Rel reticuloendotheliosis viral
oncogene homolog A (Rela)
NM_009045 M1833p65.F: GGCGGCACGTTTTACTCTTT
M1857p65.P: CGCTTTCGGAGGTGCTTTCGCAG
M1941p65.R: TCAGAGTTCCCTACCGAAGCAG
P0 Acidic ribosomal phosphoprotein XR_004667 MH181PO.F: CTCCAAGCAGATGCAGCAGA
M225PO.P: CCGTGGTGCTGATGGGCAAGAA
M267PO.R: ACCATGATGCGCAAGGCCAT
p21
WAF1/CIP1
Cyclin-dependent kinase
inhibitor 1A (p21
WAF1/CIP1
)
NM_007669 1584p21.F: GTACAAGGAGCCAGGCCAAG
peroxidase (Kit En Vision Rabbit HRP, Dako; K4002) for
30 min at room temperature. Sections were mounted with
Eukitt (Sigma-Aldrich Chimie, Lyon, France) after 4¢,
6-diamidino-2-phenylindole (DAPI) staining and visualized
on a Nikon Eclipse E60 microscope. Digital images of a
slice corresponding to the muscle midsection were acquired
with a 4 · objective, a CCD camera (Sony, Clichy, France)
and a motorized stage. Images were then analysed with
ellix software (Microvision, Evry, France).
Immunostainings were performed on transverse muscle
sections. Unfixed sections were incubated for 60 min at
room temperature in Mouse-On-Mouse blocking reagent
(Vector; MKB-2213) and then overnight at 4 °C with pri-
mary anti-CARP IgG (PTC; 11427-1-AP; dilution 1 : 50).
After extensive NaCl/P
i
washes, sections were incubated
first with biotinylated goat anti-(rabbit IgG) (Vector;
BA-1000; dilution 1 : 500) for 60 min at room temperature
and, after additional washes, with streptavidin conjugated
with Alexa Fluor 488 (Invitrogen; S11223; dilution 1 : 500).
Costainings were performed using various primary anti-
bodies [Pax7 (DSHB; Pax7-a-1ea; dilution 1 : 100) and NF
(Millipore, Saint-Quentin-en-Yvelines, France; AB5539;
dilution 1 : 50)], and detected using antibodies conjugated
to Alexa Fluor 594 (Invitrogen; goat anti-mouse A11020 or
goat anti-chicken A11042; dilutions 1 : 1000). DAPI
nuclear staining was also performed (Invitrogen; D21490).
Sections were mounted with fluoromount-G (CliniSciences,
Montrouge, France; 0100-01) and visualized on a Leica
CARP-specific polyclonal antibodies were obtained by injec-
tion of the KTLPANSVKQGEEQRK peptide into rabbits.
Horseradish peroxidase-linked donkey anti-(rabbit IgG) and
sheep anti-(mouse IgG) antibodies were purchased from
GE Healthcare Europe (Saclay, France).
Muscles from control and denervated mice were
homogenized using an ultra-turrax T8 in a buffer contain-
ing 20 mm Tris (pH 7.5), 150 mm NaCl, 2 mm EGTA,
1% Triton X-100, 2 lm E64 and protease inhibitors (com-
plete mini protease inhibitor cocktail; Roche Applied
Science). After centrifugation at 10 000 g for 10 min at
4 °C, the supernatants were recovered for western blot
analysis. The samples were denatured before SDS/PAGE
using LDS NuPage buffer (Invitrogen) supplemented with
100 mm dithiothreitol. Protein concentrations were deter-
mined by the bicinchoninic acid methodology (Thermo
Fisher Scientific, Brebie
`
res, France). Fifty micrograms of
protein samples were subjected to SDS/PAGE in precast
4–12% acrylamide gradient gels (NuPage system; Invitro-
gen) and transferred onto poly(vinylidene difluoride) mem-
branes (Millipore) by the application of an electric field
(100 V, 1 h). The transfer efficiency was evaluated by
Ponceau red protein staining (0.2% w/v, in 5% acetic
acid). The membranes were probed with antibodies
against CARP (dilution 1 : 500). Detection was performed
with secondary antibodies (dilution 1 : 10 000) coupled to
horseradish peroxidase. Visualization was performed using
the SuperSignal West Pico substrate (Pierce).
thioester cascade. Nature 373, 81–83.
5 Nury D, Doucet C & Coux O (2007) Roles and poten-
tial therapeutic targets of the ubiquitin proteasome sys-
tem in muscle wasting. BMC Biochem 8(Suppl. 1), S7.
6 Sandri M, Sandri C, Gilbert A, Skurk C, Calabria E,
Picard A, Walsh K, Schiaffino S, Lecker SH & Gold-
berg AL (2004) Foxo transcription factors induce the
atrophy-related ubiquitin ligase atrogin-1 and cause
skeletal muscle atrophy. Cell 117, 399–412.
7 Stitt TN, Drujan D, Clarke BA, Panaro F, Timofeyva
Y, Kline WO, Gonzalez M, Yancopoulos GD & Glass
DJ (2004) The IGF-1/PI3K/Akt pathway prevents
expression of muscle atrophy-induced ubiquitin ligases
by inhibiting FOXO transcription factors. Mol Cell 14,
395–403.
8 Cai D, Frantz JD, Tawa NE Jr, Melendez PA, Oh BC,
Lidov HG, Hasselgren PO, Frontera WR, Lee J, Glass
DJ et al. (2004) IKKbeta/NF-kappaB activation causes
severe muscle wasting in mice. Cell 119, 285–298.
9 Baumeister A, Arber S & Caroni P (1997) Accumulation
of muscle ankyrin repeat protein transcript reveals local
activation of primary myotube endcompartments during
muscle morphogenesis. J Cell Biol 139, 1231–1242.
10 Yang W, Zhang Y, Ma G, Zhao X, Chen Y & Zhu D
(2005) Identification of gene expression modifications in
myostatin-stimulated myoblasts. Biochem Biophys Res
Commun 326, 660–666.
11 Stevenson EJ, Giresi PG, Koncarevic A & Kandarian
SC (2003) Global analysis of gene expression patterns
during disuse atrophy in rat skeletal muscle. J Physiol
Granzier HL (2004) Altered titin expression, myocardial
stiffness, and left ventricular function in patients
with dilated cardiomyopathy. Circulation 110, 155–162.
18 Carson JA, Nettleton D & Reecy JM (2002) Differential
gene expression in the rat soleus muscle during early
work overload-induced hypertrophy. FASEB J 16, 207–
209.
19 Hentzen E, Lahey M, Peters D, Mathew L, Barash I,
Friden J & Lieber R (2006) Stress-dependent and
independent expression of the myogenic regulatory
factors and the Marp genes after eccentric contractions
in rats. J Physiol 570, 157–167.
20 Barash IA, Mathew L, Ryan AF, Chen J & Lieber
RL (2004) Rapid muscle-specific gene expression
changes after a single bout of eccentric contractions
in the mouse. Am J Physiol Cell Physiol 286, C355–
C364.
21 Chen YW, Nader GA, Baar KR, Fedele MJ, Hoffman
EP & Esser KA (2002) Response of rat muscle to acute
Cardiac ankyrin repeat protein in muscle plasticity L. Laure et al.
682 FEBS Journal 276 (2009) 669–684 ª 2008 The Authors Journal compilation ª 2008 FEBS
resistance exercise defined by transcriptional and trans-
lational profiling. J Physiol 545, 27–41.
22 Jeyaseelan R, Poizat C, Baker RK, Abdishoo S,
Isterabadi LB, Lyons GE & Kedes L (1997) A novel
cardiac-restricted target for doxorubicin. CARP, a
nuclear modulator of gene expression in cardiac progen-
itor cells and cardiomyocytes. J Biol Chem 272, 22800–
22808.
23 Zou Y, Evans S, Chen J, Kuo HC, Harvey RP & Chien
phin-deficient vs mdx skeletal muscles reveals a specific
upregulation of slow muscle genes in limb muscles.
Neurogenetics 7, 81–91.
30 Barash I, Bang ML, Mathew L, Greaser ML, Chen J &
Lieber RL (2007) Structural and regulatory roles of the
muscle ankyrin repeat protein family in skeletal muscle.
Am J Physiol Cell Physiol 293, C218–C227.
31 Bodine SC, Latres E, Baumhueter S, Lai VK, Nunez L,
Clarke BA, Poueymirou WT, Panaro FJ, Na E,
Dharmarajan K et al. (2001) Identification of
ubiquitin ligases required for skeletal muscle atrophy.
Science 294, 1704–1708.
32 Zhao J, Zhang Y, Zhao W, Wu Y, Pan J, Bauman WA
& Cardozo C (2008) Effects of nandrolone on denerva-
tion atrophy depend upon time after nerve transection.
Muscle Nerve 37, 42–49.
33 Sacheck JM, Hyatt JP, Raffaello A, Jagoe RT, Roy
RR, Edgerton VR, Lecker SH & Goldberg AL (2007)
Rapid disuse and denervation atrophy involve transcrip-
tional changes similar to those of muscle wasting during
systemic diseases. FASEB J 21, 140–155.
34 Lecker SH (2003) Ubiquitin–protein ligases in muscle
wasting: multiple parallel pathways? Curr Opin Clin
Nutr Metab Care 6, 271–275.
35 Kamei Y, Miura S, Suzuki M, Kai Y, Mizukami J,
Taniguchi T, Mochida K, Hata T, Matsuda J, Abura-
tani H et al. (2004) Skeletal muscle FOXO1 (FKHR)
transgenic mice have less skeletal muscle mass, down-
regulated type I (slow twitch/red muscle) fiber genes,
and impaired glycemic control. J Biol Chem 279,
Shomori K, Kato S, Ohama E, Sato K, Fukayama M,
Mori S et al. (2002) Altered expression of cardiac anky-
rin repeat protein and its homologue, ankyrin repeat
protein with PEST and proline-rich region, in atrophic
muscles in amyotrophic lateral sclerosis. Pathobiology
70, 197–203.
44 Nakada C, Tsukamoto Y, Oka A, Nonaka I, Takeda S,
Sato K, Mori S, Ito H & Moriyama M (2003) Cardiac-
restricted ankyrin-repeated protein is differentially
induced in Duchenne and congenital muscular dystro-
phy. Lab Invest 83, 711–719.
L. Laure et al. Cardiac ankyrin repeat protein in muscle plasticity
FEBS Journal 276 (2009) 669–684 ª 2008 The Authors Journal compilation ª 2008 FEBS 683
45 Nakada C, Oka A, Nonaka I, Sato K, Mori S, Ito H &
Moriyama M (2003) Cardiac ankyrin repeat protein is
preferentially induced in atrophic myofibers of congeni-
tal myopathy and spinal muscular atrophy. Pathol Int
53, 653–658.
46 Porter JD, Khanna S, Kaminski HJ, Rao JS, Merriam
AP, Richmonds CR, Leahy P, Li J, Guo W & Andrade
FH (2002) A chronic inflammatory response dominates
the skeletal muscle molecular signature in dystrophin-
deficient mdx mice. Hum Mol Genet 11, 263–272.
47 Suzuki N, Aoki M, Hinuma Y, Takahashi T, Onodera
Y, Ishigaki A, Kato M, Warita H, Tateyama M &
Itoyama Y (2005) Expression profiling with progression
of dystrophic change in dysferlin-deficient mice (SJL).
Neurosci Res 52, 47–60.
48 Witt CC, Ono Y, Puschmann E, McNabb M, Wu Y,
Gotthardt M, Witt SH, Haak M, Labeit D, Gregorio
Nat Med 13, 204–210.
55 Im WB, Phelps SF, Copen EH, Adams EG, Slightom
JL & Chamberlain JS (1996) Differential expression of
dystrophin isoforms in strains of mdx mice with differ-
ent mutations. Hum Mol Genet 5, 1149–1153.
56 Judge LM, Haraguchiln M & Chamberlain JS (2006)
Dissecting the signaling and mechanical functions of the
dystrophin–glycoprotein complex. J Cell Sci 119, 1537–
1546.
57 Snyder RO, Miao CH, Patijn GA, Spratt SK, Danos
O, Nagy D, Gown AM, Winther B, Meuse L, Cohen
LK et al. (1997) Persistent and therapeutic concentra-
tions of human factor IX in mice after hepatic gene
transfer of recombinant AAV vectors. Nat Genet 16,
270–276.
58 Bartoli M, Poupiot J, Goyenvalle A, Perez N, Garcia
L, Danos O & Richard I (2006) Noninvasive monitor-
ing of therapeutic gene transfer in animal models of
muscular dystrophies. Gene Ther 13, 20–28.
Cardiac ankyrin repeat protein in muscle plasticity L. Laure et al.
684 FEBS Journal 276 (2009) 669–684 ª 2008 The Authors Journal compilation ª 2008 FEBS