The
Saccharomyces cerevisiae
type 2A protein phosphatase Pph22p
is biochemically different from mammalian PP2A
Piotr Zabrocki
1
, Wojciech Swiatek
1
, Ewa Sugajska
1
, Johan M. Thevelein
2
, Stefaan Wera
2
and Stanislaw Zolnierowicz
1,
*
1
Cell and Molecular Signaling Laboratory, Intercollegiate Faculty of Biotechnology UG-MUG, Gdansk, Poland;
2
Laboratorium
voor Moleculaire Celbiologie, K.U. Leuven, Leuven-Heverlee, Flanders, Belgium
The Saccharomyces cerevisiae type 2A protein phosphatase
(PP2A) Pph22p differs from the catalytic subunits of PP2A
(PP2Ac) present in mammals, plants and Schizosaccharom-
yces pombe by a unique N-terminal extension of approxi-
mately 70 amino acids. We have overexpressed S. cerevisiae
Pph22p and its N-terminal deletion mutant DN-Pph22p in
the GS115 strain of Pichia pastoris and purified these
enzymes to apparent homogeneity. Similar to other
heterologous systems used to overexpress PP2Ac, a low yield

Pichia pastoris.
Reversible protein phosphorylation catalysed by protein
kinases and phosphoprotein phosphatases is a major
mechanism utilized by eukaryotic organisms to regulate
various cellular processes [1]. Protein kinases are apparently
derived from one primordial gene. In contrast, protein
phosphatases are encoded by at least three unrelated gene
families. Based on primary and tertiary structure similarit-
ies, protein phosphatases are currently classified into PPP,
Mg
2+
-dependent PPM (both PPP and PPM are specific
against phosphoserine/phosphothreonine residues) and
PTP (phosphotyrosine residues-specific) families [2,3]. The
PTP family comprises also dual-specificity phosphatases
that are able to dephosphorylate all three phospho-residues
[4]. Mammalian type 2A protein phosphatase (PP2A), a
member of the PPP family, displays a broad substrate
specificity in vitro. However, its in vivo substrate selectivity,
enzymatic activity and subcellular localization are regulated
by the association with regulatory subunits [5,6]. Thus, two
different dimeric forms of PP2A are formed by the
association of the catalytic subunit (PP2Ac) with PR65/A
scaffolding subunit or a4 protein. In addition, association of
a third variable subunit derived from the unrelated protein
families PR55/B, PR61/B¢ or PR72/B¢¢ to the PR65/A–
PP2Ac dimer results in the formation of trimeric PP2A [6].
In vivo substrates of PP2A in mammalian cells comprise
protein kinases and transcription factors [7]. However, the
identity of many physiological substrates of PP2A still

and PPH22 [10]. Both Pph21p and Pph22p are involved in
actin cytoskeleton reorganization, bud morphogenesis and
cell cycle progression from G
2
to M [11–13]. Pph21p and
Pph22p are highly similar (87%) and apparently perform
overlapping functions. Deletion of both PP2A catalytic
subunit genes in budding yeast results in very slow growth.
Additional deletion of the PP2A-related PPH3 gene is lethal
[11,14]. Four polypeptides, encoded by CDC55, TPD3,
RTS1 and TAP42, form complexes with PP2A catalytic
subunits in yeast [12,15–17]. Cdc55p, Tpd3p, Rts1p and
Tap42p correspond, respectively, to mammalian PR55/B,
PR65/A, PR61/B¢ and a4. The corresponding genes are not
essential but their mutation results in specific phenotypes.
Moreover, two genes (RRD1 and RRD2) encoding homo-
logues of mammalian phosphotyrosine phosphatase activa-
tor (PTPA), a protein isolated from mammalian tissue
based on its ability to stimulate PP2A activity against
phosphotyrosine residues, are present in the budding yeast
genome [18,19].
All catalytic subunits of PP2A from various species are
subject to diverse regulatory control mechanisms. Carbo-
xymethylation of Leu309 (Leu377 of S. cerevisiae) influen-
ces PP2A activity of PP2A and is a signal for exchanging
variable regulatory B family subunits [20–22] (reviewed in
[23]). Phosphorylation of Tyr307 is dependent on insulin,
epidermal growth factor, interleukin-1, tumour necrosis
factor a (and some other pathways) and inactivation of
phosphatase activity (reviewed in [24]). However no data

instructions. Escherichia coli strains DH5a and Top 10F¢
were used for all plasmid constructions and propagations.
The following media were used to grow P. pastoris:RDB-
agar: 1
M
sorbitol, 2% glucose, 1.34% yeast nitrogen base
without amino acids, 4 · 10
)5
% biotin, 2% agar; MD
medium: 1.34% yeast nitrogen base without amino acids,
4 · 10
)5
% biotin, 2% glucose; MM medium: 1.34% yeast
nitrogen base without amino acids, 4 · 10
)5
%biotin,0.5%
methanol; YPD: 1% yeast extract, 2% peptone, 2% glucose
pH 5.8 adjusted with HCl; MGY medium: 1.34% yeast
nitrogen base without amino acids, 4 · 10
)5
%biotin,1%
glycerol. The following buffers were applied to purify
recombinant Pph22p and DN-Pph22p: SCED buffer: 1
M
sorbitol, 10 m
M
sodium citrate pH 7.5, 10 m
M
EDTA,
10 m

Tris/HCl pH 7.5, 450 m
M
NaCl, 30 m
M
imidazole, 5% glycerol and 0.01% Triton
X-100; buffer C: 20 m
M
Tris/HCl pH 7.5, 20% glycerol
(± 0.5 m
M
dithiothreitol).
Molecular cloning of the Pph22p expression constructs
Genomic DNA of S. cerevisiae strain W303 was obtained
by the ammonium acetate method [30] and used as template
to amplify the PPH22 open reading frame with Pfu DNA
polymerase (Stratagene) using a standard protocol. The
following primers were used: sense (1), 5¢-CG
GGATCC
ACCATGCATCATCATCATCATCATCATCATGATA
TGGAAATTGATGACCCTATG-3¢ (BamHI site under-
lined, 8 · His-tag bold) and antisense (2), 5¢-CG
GAA
TTCTTATAAGAAATAATCCGGTGTCTTC-3¢ (EcoRI
site underlined). For cloning of DN-Pph22p (Pph22p
without first 77 amino acids) and the N-terminus of Pph22p
(only the first 77 amino acids) we used: sense primer:
5¢-CG
GGATCCACCATGCATCATCATCATCATCAT
CATCATCTTGACCAATGGATTGAGCATTTG-3¢
(BamHI site underlined, 8 · His-tag bold) and antisense:

antisense oligonucleotides to amplify the PPH22 gene
(sequences listed above). Transformants obtained using
undigested plasmid DNA in KM71 strain and those
obtained after linearization of plasmid with both SalIand
NotI in GS115 in case Pph22p were used for further
evaluation. In case DN-Pph22p and N-terminus of Pph22p
transformants obtained from both kind of DNA (undigest-
edanddigestedwiththeSalI) were used for further
experiments. In order to select transformants with the
highest copy number of PPH22 genes and mutants genes
inserted into the Pichia genome, yeast colonies were
transferredtoYPD-agarplatesorYPD-agarplatescon-
taining G418 (Calbiochem) added at 2 and 4 mgÆmL
)1
.The
fastest growing colonies were selected from YPD-agar
plates containing 4 mgÆmL
)1
G418 and those were selected
for mini-scale expression studies.
Mini-scale expression of Pph22p and DN-Pph22p
in
P. pastoris
Recombinants obtained in the KM71 strain (His
+
Mut
S
,
slow methanol utilization) or in the GS115 strain (either
His

and analyzed for the presence of the heterologous protein
by SDS/PAGE with Coomassie staining, immunodetection
with Tetra-His antibodies (Qiagen) and phosphatase
activity measurements. Recombinant GS115 (His
+
Mut
+
)
obtained after transformation of yeast with the NotI
linearized plasmid displaying the highest level of Pph22p
expression, was used for further experiments. In case of
DN-Pph22p and N-terminus for further experiments trans-
formants GS115 (His
+
Mut
+
) obtained with plasmids
linearized with the SalIwereused.
Midi-scale expression of recombinant proteins
in
P. pastoris
For the midi-scale expression of proteins the selected GS115
(His
+
Mut
+
) strain was cultured in a 100-mL baffled flask
in 25 mL of MGY medium at 30 °C with shaking at
205 r.p.m. This yeast preculture reached an D
600

centrifugation, dissolved in 20 mL of buffer A and dialysed
against buffer A. The dialysate was loaded at a flow rate of
15 mLÆh
)1
onto a DEAE-Sephacel column (2 · 10 cm)
equilibrated previously with buffer A. The column was
washed with 20 column volumes of buffer A and
phosphatase activity was eluted with a linear gradient
from 170 m
M
to 500 m
M
NaCl (in the case of DN-Pph22p
from 150 to 700 m
M
NaCl) in buffer A collecting 3-mL
fractions. The fractions containing phosphatase activity
were combined, dialysed against buffer B and loaded onto
aNi
2+
-nitrilotriacetate agarose (Qiagen) column
(2 · 3 cm). The column was washed with buffer B and
protein eluted with a linear gradient of imidazole from 30
to 200 m
M
, collecting 2-mL fractions. The fractions were
analysed by immunodetection with Tetra-His antibodies
and phosphatase activity assays. Combined fractions
corresponding to the peak of Pph22p activity were dialysed
against buffer C with or without dithiothreitol and stored

), were included in the assay
buffer. The recombinant PR65/A subunit was preincubated
with PP2Ac, Pph22p or DN-Pph22p in 20 m
M
Tris/HCl
pH 7.4, 50 m
M
NaCl, 0.1 m
M
EDTA and 0.1% 2-mercapto-
ethanol for 10 min at 30 °C before the reaction was
started with
32
P-labelled phosphorylase a. To measure the
effect of pH on PP2A activity the buffer containing 20 m
M
sodium acetate/acetic acid, 20 m
M
imidazole/HCl and
20 m
M
Tris/HCl covering pH from 5.0 to 10.0 was applied.
One unit of phosphatase activity corresponds to 1 lmol of
32
P
i
released from
32
P-labelled phosphorylase a per min at
30 °C.

illustrated data represent the mean of at least two
independent experiments.
Preparation of liposomes
Phospholipids were solubilized in chloroform and after
evaporation of chloroform were resuspended in 50 m
M
Tris
pH 7.4, 0.1 m
M
EDTA, 0.1% 2-mercaptoethanol buffer by
sonication under argon. Sonication was carried out in an
ice-bath for 10 min with breaks (24 kHz) (BioMetra
Ultrasonicator). Before use, liposomes were kept for 2 h
on ice to allow association of lipids.
Determination of the influence of disulfides on yeast
and mammalian recombinant PP2Ac
Pph22p, PP2Ac and DN-Pph22p were incubated with
20 m
M
dithiothreitol overnight at 4 °C. Mixtures were
dialyzed extensively against buffer containing 50 m
M
Tris,
pH 7.4, 0.1 m
M
EDTA and 20% glycerol. Determination
of the influence of glutathione disulfide (GSSG) and
reduced glutathione (GSH) was carried out by mixing this
redox agent with the purified phosphatase and incubation at
30 °C for 30 min. The phosphatase assay was initialized by

RESULTS AND DISCUSSION
Comparison of PP2A catalytic subunits
from
S. cerevisiae
and other species
S. cerevisiae protein phosphatases encoded by PPH21 and
PPH22 are homologues of mammalian PP2Ac. Pph21p
consists of 369 amino acids and Pph22p of 377 amino acids.
Both enzymes are hence larger than PP2Ac from mammals,
plants and S. pombe which are composed of 306–322 amino
acids. This difference in size results from the presence of an
acidic stretch of approximately 70 amino acids (pI 3.78 and
4.07 for Pph21p and Pph22p, respectively) at the N-termini
of Pph21/Pph22p (Fig. 1). The role of this N-terminal
extension present in budding yeast PP2Ac is currently
unknown. One may speculate that these regions are
responsible for targeting Pph21p and Pph22p to intracellu-
lar compartments or to specific substrates, or fulfil a special
regulatory function. Interestingly, the N-terminal regions of
Pph21p and Pph22p are quite divergent showing only
49.4% amino-acid sequence identity (the first N-terminal 42
amino acids of Pph22p display only 33.3% identity to the
corresponding region in Pph21p) whereas the overall
identity between enzymes equals 87%. This might indicate
that the N-termini of Pph21p and Pph22p may have distinct
functions. In order to determine whether the N-terminal
extension present in Pph22p influences its biochemical
properties we decided to overexpress this phosphatase and
its deletion mutant without 77 N-terminal amino acids in
P. pastoris, purify these enzymes to apparent homogeneity

Phosphorylase phosphatase activity was measured in cell-
free extracts of all strains and its dependence on growth
phase (reflected in D
600
value) was analysed. At stationary
phase (high D
600
), both Pph22p and DN-Pph22p proteins
were maximally overexpressed 24 h after methanol induc-
tion; amounts of active phosphatase decreased after this
Ó FEBS 2002 Characterization of protein phosphatase Pph22p (Eur. J. Biochem. 269) 3375
time, as confirmed also by Western blotting analysis (data
not shown).
The long lag period in the growth of the GS115-PPH22
strain observed after transferring the cells to methanol-
containing medium is similar to that described for the strain
overexpressing human PP2Ac [29] and might reflect effects
of higher phosphatase activity on yeast growth or on the cell
cycle.
Figure 2 illustrates the purification of Pph22p and
DN-Pph22p from P. pastoris cells using ammonium sulfate
fractionation, DEAE-Sephacel and Ni
2+
-nitrilotriacetic
acid agarose, as described in the Materials and methods
section. The final preparation, stained with Coomassie
Brilliant Blue, appeared to be homogeneous. Purity was
confirmed by gel filtration (data not shown). Pph22p and
DN-Pph22p proteins were purified with a yield of active
protein of 80 and 60 lgÆL

protein phosphatase [32]. In agreement with this, none of
metal ions tested increased significantly the activity of
Pph22p, DN-Pph22p or PP2Ac (Table 1). In contrast,
several metal ions applied at a concentration of 1 m
M
(Co
2+
,Ni
2+
,Fe
2+
,Fe
3+
and Zn
2+
) inhibited Pph22p
and PP2Ac activities with phosphorylase a as a substrate. In
order to exclude the latter effects being substrate dependent
we confirmed the data from Table 1 using kemptide as
substrate (not shown). It remains to be determined whether
the inhibitory effect of these high concentrations of metal
ions reflect an interaction with SH groups exposed on the
enzyme surface or formation of complexes with amino-acid
Pph22_S.cerevisiae
Pph21_S.cerevisiae
ppa1_S.pombe
PP2Ac/beta_rabbit
PP2Ac/alfa_H.sapiens
ppa2_pombe
PP2Ac_2_A.thaliana

DN-Pph22p.
3376 P. Zabrocki et al. (Eur. J. Biochem. 269) Ó FEBS 2002
residues involved in catalysis. Some metal ions, e.g. Co
2+
and Ni
2+
, might interact with the N-terminal His-tag, but
this is unlikely to explain the effect on phosphatase activity,
because even (nonrecombinant) PP2A purified from rabbit
skeletal muscle is inhibited by  20–30% by these ions at a
concentration of 0.75 m
M
(data not shown).
Mammalian PP2Ac is inhibited by several naturally
occurring compounds in a way that allows this enzyme to be
distinguished from PP1 [33]. In contrast, more recently
discovered protein phosphatases such as PP4 and PP6,
which are present in mammalian cells in much smaller
quantities, are inhibited similarly to PP2A. Figure 3
presents inhibition of purified Pph22p by okadaic acid,
nodularin, cantharidin and endothall. The IC
50
values
calculated at 3 n
M
concentration of Pph22p were 0.2, 0.5,
130 and 210 n
M
, respectively, and were very similar to those
obtained for DN-Pph22p (data not shown). For PP2Ac

,
protamine (and 16 m
M
ammonium sulfate) an 11-fold
activation of Pph22p was observed. Protamine, in the
presence of the same concentration of ammonium sulfate,
had little effect on human PP2Ac and on DN-Pph22p
(Fig. 4A). In contrast, 33 lgÆmL
)1
, protamine together with
16 m
M
ammonium sulfate stimulated the activity of the
PP2Ac-PR65/A dimer about 12-fold and that of the
DN-Pph22p-PR65/A dimer around fourfold (Fig. 4B).
Hence, with respect to protamine stimulation of phospha-
tase activity, the yeast catalytic subunit Pph22p behaved
similarly to the PP2Ac-PR65/A dimer, but mutant
DN-Pph22p behaved like PP2Ac. As can be seen in Fig. 4B,
addition of PR65/A subunit to Pph22p increased the
protamine activation a further 1.8-fold.
Fig. 3. Inhibition of Pph22p activity by okadaic acid, nodularin, can-
tharidin and endothall. Purified Pph22p applied at 3 n
M
was incubated
with the indicated concentration of inhibitor at 30 °Cfor10min
before the reaction was initiated with
32
P-labelled phosphorylase a as
substrate.

0.1 74 41
0.3 39 11
122 8
Fe
2+
0.1 110 103
0.3 106 54
174 7
Fe
3+
0.1 115 82
0.3 79 17
115 2
Ni
2+
0.1 69 88
0.3 35 13
118 4
Mg
2+
0.1 100 112
0.3 100 130
1 93 129
Ca
2+
0.1 110 106
0.3 77 91
166 76
Zn
2+

with 0.5
M
NaCl from the gel (Fig. 4D).
In order to determine the effect of other polycations on
phosphorylase phosphatase activity of yeast and mamma-
lian PP2Ac poly-
L
-lysine was added to the purified
enzymes. As presented in Fig. 5 a peak of poly-
L
-lysine-
stimulated phosphorylase phosphatase activity was
observed at 20 lg poly-
L
-lysine per mL for both enzymes,
but the extend of activation of Pph22p was much more
pronounced (4.5-fold activation of Pph22p activity vs.
2.5-fold activation of PP2Ac). PR65/A subunit (3 n
M
)
increased activation of PP2Ac by poly-
L
-lysine by
approximately 70% and it also increased stimulation of
Pph22p by poly-
L
-lysine another 50%. From Fig. 5 it is
clear that the activation (4.5-fold) of Pph22p by
20 lgÆmL
)1

ammonium sulfate. (C) Phosphatase activity of the indicated concentrations of
Pph22p (squares), DN-Pph22p (triangles) and PP2Ac (circles) was assayed using
32
P-labelled phosphorylase a as a substrate in the absence (open
symbols) or presence (closed symbols) of 3 n
M
purified PR65a/A subunit. (D) Binding of PP2Ac, DN-Pph22p and Pph22p to protamine-agarose.
Immunodetection of Pph22p/DN-Pph22p/PP2Ac was carried out on a Western blot after separation of protein fractions on 10% SDS-poly-
acrylamide gel. Lanes 1 and 2, material loaded to the column; lane 3, flow-through; lanes 4, 5 and 6, material eluted with 50 m
M
,500m
M
and 1
M
NaCl, respectively; lane 7, material eluted with 1 · SDS/PAGE buffer.
3378 P. Zabrocki et al. (Eur. J. Biochem. 269) Ó FEBS 2002
(4.5-fold) of the human PP2Ac-PR65/A dimer by
20 lgÆmL
)1
poly-
L
-lysine and much stronger than that of
the free human catalytic subunit PP2Ac. Interestingly the
deletion mutant DN-Pph22p behaved more like PP2Ac.
DN-Pph22p is only around 70% activated by poly
L
-lysine
and even the DN-Pph22p/PR65a dimerislessstimulated
than Pph22p alone (Fig. 5). Again these data point to a
domain present in the yeast Pph22p N-terminus respon-

Fig. 6. Influence phospholipids on Pph22p and DN-Pph22p activity. Phosphatase assays were carried out as described in Materials and Methods.
(A) Influence of egg yolk phosphatidic acid (PA) and synthetic dioleoylphosphatidic acid (DOPA) on Pph22p and DN-Pph22p phosphatase activity
(B) Influence of phosphatidylserine (PS) and (C) phosphatidylethanolamine (PE) on Pph22p and DN-Pph22p phosphatase activity (D) Effects
of dioleoylphosphatidylcholine (DOL) and phosphatidylcholine (L) on Pph22p and DN-Pph22p phosphatase activity. Phosphatases at a con-
centration of 2.3 n
M
were used to measure the effects of phospholipids on its activity. Lipids were solubilized in chloroform and after evaporation
of chloroform were resuspended in 50 m
M
Tris,pH7.4,0.1m
M
EDTA, 0.1 m
M
2-mercaptoethanol buffer and sonicated. Liposomes were added
to phosphatase and reactions were incubated on ice for 30 min and phosphatase activity in samples were determined (see Materials and
methods).
Ó FEBS 2002 Characterization of protein phosphatase Pph22p (Eur. J. Biochem. 269) 3379
calculated concentration of 4–400 l
M
and after 10 min
incubation on ice, a time where effects were maximal.
Phosphatidic acid from egg yolk (PA) stimulated Pph22p
activity, but it inhibited DN-Pph22p. Inhibition reached
70% for DN-Pph22p at 320 l
M
concentration with IC
50
around 80 l
M
of lipid (Fig. 6A). The same lipid stimulated

and recombinant human PP2Ac catalytic subunit as
control. Figure 7A illustrates the influence of various
concentrations of GSSG on PP2Ac, Pph22p and
DN-Pph22p phosphatases. All these enzymes are inactivated
in a similar way by GSSG, but interestingly only Pph22p
activity is also inhibited by GSH. GSH at 6 m
M
concen-
tration has no effect on recombinant human PP2Ac and in
low concentrations even slightly stimulates PP2Ac activity
(Fig. 7A) (data not shown).
We then checked the influence of reducing agents on the
activity of phosphatases. Dithiothreitol and 2-mercapto-
ethanol can reactivate PP1 and PP2A phosphatases from
rabbit skeletal muscle inactivated by GSSG [27]. We tested
whether both Pph22p and DN-Pph22p were reactivated by
dithiothreitol and 2-mercaptoethanol. As a control recom-
binant PP2Ac was used. Pph22p and DN-Pph22p were not
reactivated, even at 50 m
M
concentration dithiothreitol or
2-mercaptoethanol, while PP2Ac was reactivated by both
reducing agents to around 15% of its original activity
(Fig. 7B). This is in agreement with data reported previ-
ously [27], where authors have shown slight reactivation of
PP2A from rabbit skeletal muscle and very high levels of
reactivation of rabbit PP1. Pph22p cannot be reactivated
under our conditions by reducing agents, moreover
2-mercaptoethanol and in lesser extend dithiothreitol, even
decrease the activity of Pph22p, in contrast to PP2Ac,

test of PP2Ac, DN-Pph22p and Pph22p phosphatases inactivated by
incubation with 20 m
M
GSSG. After inactivation phosphatases were
dialysed extensively and assayed for activity after 10 min incubation
with dithiothreitol or 2-mercaptoethanol in the indicated concentra-
tions. A 2.5-n
M
concentration of PP2Ac, Pph22p and DN-Pph22p was
used. On the graph, the solid squares precisely overlap the open
squares.
3380 P. Zabrocki et al. (Eur. J. Biochem. 269) Ó FEBS 2002
Pph22p in P. pastoris, purified this phosphatase to
apparent homogeneity, determined its enzymatic proper-
ties and compared them to those of mammalian PP2Ac.
This analysis shows that although both enzymes share a
number of characteristics (specific activity, sensitivity to
inhibitors, inhibition by high concentrations of metal
ions), they show a remarkably different response to
protamine, polylysine and reducing agents. Using purified
Pph22p lacking the N-terminus, we can attribute most of
these differences to the unique N-terminal extension
present in Pph22p. In contrast to PP2Ac and DN-Pph22p,
Pph22p strongly interacts with protamine resulting in
stimulation of enzymatic activity. The stimulation of
catalytic activity of Pph22p by protamine and polylysine
reflects the stimulation of the mammalian PP2Ac-PR65/A
dimeric form of the phosphatase. The N-terminus of
Pph22p also influences interactions of Pph22p with
specific phospholipids or membranes. Our data therefore

A.M., Hodges, P.E., Kondu, P., Lengieza, C., Lew-Smith, J.E.,
Lingner, C., Roberg-Perez, K.J., Tillberg, M., Brooks, J.E. &
Garrels, J.I. (2000) The yeast proteome database (YPD)
and Caenorhabditis elegans proteome database (WormPD):
comprehensive resources for the organization and comparison
of model organism protein information. Nucleic Acids Res. 28,
73–76.
10. Sneddon, A.A., Cohen, P.T.W. & Stark, M.J.R. (1990)
Saccharomyces cerevisiae protein phosphatase 2A performs an
essential cellular function and is encoded by two genes. EMBO J.
9, 4339–4346.
11. Evans, D.R.H. & Stark, M.J.R. (1997) Mutations in the
Saccharomyces cerevisiae type 2A protein phosphatase catalytic
subunit reveal roles in cell wall integrity, actin cytoskeleton orga-
nization and mitosis. Genetics 145, 227–241.
12. Di Como, C.J. & Arndt, K.T. (1996) Nutrients, via the Tor pro-
teins, stimulate the association of Tap42 with type 2A phospha-
tase. Genes Dev. 10, 1904–1916.
13. Lin, F.C. & Arndt, K.T. (1995) The role of Saccharomyces
cerevisiae type 2A phosphatase in the actin cytoskeleton and in
entry into mitosis. EMBO J. 14, 2745–2759.
14. Ronne, H., Carlsberg, M., Hu, G Z. & Nehlin, J.O. (1991)
Protein phosphatase 2A in Saccharomyces cerevisiae:effectson
cell growth and bud morphogenesis. Mol. Cell. Biol. 11,4876–
4884.
15. Healy, A.M., Zolnierowicz, S., Stapleton, A.E., Goebl, M.,
DePaoli-Roach, A.A. & Pringle, J.R. (1991) CDC55,aSacchar-
omyces cerevisiae gene involved in cellular morphogenesis: iden-
tification, characterization, and homology to the B subunit of
mammalian type 2A protein phosphatase. Mol. Cell. Biol. 11,

efficient interaction with the B-type subunits Cdc55p and Rts1p.
J. Biol. Chem. 276, 1570–1577.
23. Zabrocki, P., Van Hoof, C., Goris, J., Thevelein, J.M., Windericx,
J. & Wera, S. (2002) Protein phosphatase 2A on track for nutrient-
induced signalling in yeast. Mol. Microbiol. 43, 835–842.
24. Janssens, V. & Goris, J. (2001) Protein phosphatase 2A: a highly
regulated family of serine/threonine phosphatases implicated in
cell growth and signalling. Biochem. J. 353, 417–439.
25. Guo, H. & Damuni, Z. (1993) Autophosphorylation – activated
protein kinase phosphorylates and inactivates protein phospha-
tase 2A. Proc. Natl Acad. Sci. USA 90, 2500–2504.
26. Kishikawa, K., Chalfant, C.E., Perry, D.K., Bielawska, A. &
Hannun, Y.A. (1999) Phosphatidic acid is a potent and selective
inhibitor of protein phosphatase 1 and an inhibitor of ceramide-
mediated responses. J. Biol. Chem. 274, 21335–21341.
27. Nemani, R. & Lee, E.Y.C. (1993) Reactivity of sulfhydryl groups
of the catalytic subunits of rabbit skeletal muscle protein phos-
phatase 1 and 2A. Arch. Biochem. Biophys. 300, 24–29.
28. Holmes, C.F.B. & Boland, M. (1993) Inhibitors of protein phos-
phatase-1 and -2A; two of the major serine/threonine protein
Ó FEBS 2002 Characterization of protein phosphatase Pph22p (Eur. J. Biochem. 269) 3381
phosphatases involved in cellular regulation. Curr. Opin. Struct.
Biol. 3, 934–943.
29. Swiatek, W., Sugajska, E., Lankiewicz, L., Hemmings, B.A. &
Zolnierowicz, S. (2000) Biochemical characterization of
recombinant subunits of type 2A protein phosphatase over-
expressed in Pichia pastoris. Eur. J. Biochem. 267, 5209–5216.
30. Hoffman, C.S. & Winston, F. (1987) A ten-minute DNA pre-
paration from yeast efficiently releases autonomous plasmids for
transformation of Escherichia coli. Gene 57, 267–272.