Essential role of the C-terminus in Melanocarpus
albomyces laccase for enzyme production, catalytic
properties and structure
Martina Andberg
1
, Nina Hakulinen
2
, Sanna Auer
1
, Markku Saloheimo
1
, Anu Koivula
1
,
Juha Rouvinen
2
and Kristiina Kruus
1
1 VTT Technical Research Center of Finland, Finland
2 Department of Chemistry, University of Joensuu, Finland
Introduction
Laccases (EC 1.10.3.2; p-dihenol dioxygen oxidoreduc-
tases) are copper-containing metalloenzymes that
oxidize various phenolic compounds, anilines and even
some nonaromatic compounds by a one-electron
removal mechanism, which usually generates radicals.
Oxidation of reducing substrates occurs concomitantly
with the reduction of molecular oxygen to water. Lac-
cases are ubiquitous enzymes found in various micro-
organisms, insects, and plants. They share structural
similarities with other blue multicopper oxidases,
derma reesei and Saccharomyces cerevisiae. Changes in the C-terminus of
MaL caused major defects in protein production in both expression hosts.
The deletion of the last four amino acids dramatically affected the activity
of the enzyme, as the deletion mutant delDSGL
559
was practically inactive.
Detailed characterization of the purified L559A mutant expressed in
S. cerevisiae showed the importance of the C-terminal plug for laccase
activity, stability, and kinetics. Moreover, the crystal structure of the
L559A mutant expressed in S. cerevisiae showed that the C-terminal muta-
tion had clearly affected the trinuclear site geometry. The results in this
study clearly confirm the critical role of the last amino acids in the
C-terminus of MaL.
Abbreviations
2,6-DMP, 2,6-dimethoxyphenol; ABTS, 2,2¢-azinobis(3-ethylbenzo-6-thiazolinesulfonic acid); BsL, Bacillus subtilis laccase; MaL,
Melanocarpus albomyces laccase; rMaL, recombinant MaL expressed in T. reesei; Sc(delDSGL559), Melanocarpus albomyces laccase
delDSGL559 mutant expressed in Saccharomyces cerevisiae; Sc(L559A), Melanocarpus albomyces laccase L559A mutant expressed in
Saccharomyces cerevisiae; ScMaL, Melanocarpus albomyces laccase expressed in Saccharomyces cerevisiae; Tr(delDSGL
559
),
Melanocarpus albomyces laccase delDSGL
559
mutant expressed in Trichoderma reesei; Tr(L559G), Melanocarpus albomyces laccase L559G
mutant expressed in Trichoderma reesei.
FEBS Journal 276 (2009) 6285–6300 ª 2009 The Authors Journal compilation ª 2009 FEBS 6285
including ascorbate oxidase, ceruloplasmin, CueO, and
Fet3p. For catalytic activity, all four copper atoms are
needed: one type 1 (T1) copper forming a mononuclear
site, and one type 2 (T2) copper and two type 3 (T3
and T3¢) coppers forming a trinuclear site.
a chloride ion attached to the T2 copper, whereas
other crystal structures of multicopper oxidases have
hydroxyl ion ⁄ water in this position. The role of the
chloride ion is unknown. A number of anions, i.e.
CN
)
,N
3
)
, and F
)
, are known to act as effective lac-
case inhibitors [11,12]. However, chloride ion does not
act as an inhibitor for MaL, as shown by Kiiskinen
et al. [1]. Instead, azide is a well-known inhibitor of
MaL. According to spectroscopic measurements, the
binding of azide has been suggested to bridge the T2
copper and one of the T3 coppers [13,14], or bind to
one T3 copper, as observed in the crystal structure of
ascorbate oxidase [15]. Recently, the azide was found
to bind between two T3 coppers in the crystal struc-
ture of BsL [5].
The three-dimensional structure of MaL revealed
that the C-terminus of the enzyme penetrates to a
tunnel leading to the trinuclear site (Fig. 1). This
unique feature has not been observed in any other
published laccase crystal structures. Instead, in other
known laccases, this cavity is open, and it is thought
to provide access to the fresh oxygen molecules
needed in the catalytic cycle. The C-terminus of MaL
all ascomycete laccases. The conserved C-terminus of
ascomycete laccases might have a special role in the
enzyme.
In order to analyze the role of the C-terminus, site-
directed mutagenesis of MaL cDNA was performed,
and the mutated proteins and wild-type enzyme were
expressed in Trichoderma reesei and Saccharomyces
cerevisiae. We report here the characterization of the
C-terminal mutants and the three-dimensional structure
of the L559A mutant expressed in S. cerevisiae
[Sc(L559A)].
Results
Production and characterization of MaL mutants
expressed in T. reesei
Two mutations were made in the MaL gene, and the
mutated proteins were expressed in T. reesei. The
mutated laccase constructs were produced by site-
directed mutagenesis on the plasmid pLLK8, a T. ree-
sei expression vector containing the cDNA coding for
MaL between the cbh1 promoter and terminator. In
the L559G mutant expressed in T. reesei [Tr(L559G)],
Leu559 was replaced with a Gly to change the pro-
cessing site to prevent C-terminal cleavage, and in
the delDSGL
559
mutant expressed in T. reesei
[Tr(delDSGL
559
)], an Asp at position 556 was replaced
by a stop codon to delete the last four amino acids
culture supernatants of the mutants were considerably
reduced. In fact, no activity could be detected for the
Tr(delDSGL
559
) mutant, although amounts detectable
by western blot analysis were expressed into the super-
natant. The ABTS activity in the culture supernatant
of the Tr(L559G) mutant was several hundred-fold
lower than that of the wild-type rMaL. Comparison of
the production level and the activity in the culture
supernatant showed the specific activity of the mutants
to be considerably lower than that of the wild-type
enzyme. In addition to having low expression levels,
the Tr(L559G) and Tr(delDSGL
559
) mutants were
partly degraded (Fig. S1, lanes 2 and 3). Some laccase
degradation products were also detected in the culture
supernatants of the wild-type rMaL produced in the
two strains, but the ratio of degraded laccase to full-
length laccase was much higher in the mutant strains.
Changes in the original C-terminus thus caused major
defects in protein production in T. reesei as well as
changes in the protein properties.
The T. reesei strain producing the Tr(delDSGL
559
)
protein was also cultivated in a laboratory-scale
bioreactor (20 L), and the protein was purified from
the culture supernatant by applying the procedure
was performed with another construct, pMS175, where
mature MaL cDNA, with a stop codon, was intro-
duced after the C-terminal processing site [16].
The effects of using S. cerevisiae as expression host
on the properties of M. albomyces laccase (ScMaL)
were also studied. The conditions for production of
ScMaL in shake flask cultures were optimized in terms
of CuSO
4
concentration in the medium, temperature,
culture medium, and induction conditions. The opti-
mal culture conditions were found to be as follows:
synthetic complete medium (SC-URA) buffered to pH
6 with succinate and supplemented with 1 mm CuSO
4
at 250 r.p.m. and 30 °C. Yeast cells were grown on
raffinose (20 gÆL
)1
), and a washing step prior to a
change to induction medium containing galactose
(20 gÆL
)1
) was shown to have a positive effect on lac-
case production. The production level in shake flask
cultures was about 4.5 nkatÆmL
)1
(ABTS activity),
roughly corresponding to 7 mgÆL
)1
ScMaL, when
activity of rMaL (840 nkatÆmg
)1
). However, the K
m
values for ABTS showed practically no difference
between the MaL preparations expressed in S. cerevi-
siae and T. reesei. Also, the temperature stability was
similar for ScMaL and rMaL. The N-terminal
sequencing verified correct processing of the yeast
a-prepro sequence (KEX2 cleavage site). Removal of
the glycans by enzymatic deglycosylation with endo-
b-N-acetylglucosaminidase F1 slightly lowered the
specific ABTS activity of ScMaL, but had no effect on
the specific activity of rMaL. Deglycosylation of over-
glycosylated ScMaL resulted in one pI isoform of the
enzyme, in contrast to the several isoforms seen with
the enzyme still having the glycans attached. The
results confirmed that MaL can be expressed in
S. cerevisiae and that the protein properties are com-
parable to those of the wild-type laccases and the lac-
case expressed heterologously in T. reesei.
Production and purification of the Sc(delDSGL
559
)
and Sc(L559A) mutants
Two C-terminal mutants of MaL, Sc(delDSGL
559
) and
Sc(L559A), were expressed in S. cerevisiae, and the
proteins were purified to homogeneity from the yeast
strate was not detectable in the Sc(delDSGL
559
) culture
supernatant, or in the concentrated culture filtrate,
although the expression of the mutant laccase was
confirmed by western blot analysis. The result clearly
confirms that the last four amino acids are essential
for enzyme activity. In the culture supernatant of
Sc(L559A), the activity on ABTS was 1.8 nkatÆmL
)1
,
which was 2.5-fold lower than the activity for ScMaL
(4.5 nkatÆmL
)1
).
The Sc(delDSGL
559
) mutant was purified in four
subsequent chromatographic steps. As the Sc(del-
DSGL
559
) mutant was not active in the culture super-
natant or after the first purification steps, the pooling
of the laccase-containing fractions was based on anti-
body detection on dot blots. In the pooled fractions
after the third hydrophobic interaction step, very low
but detectable laccase activity on ABTS could be
observed. The specific activities in two separate pools
were 0.21 and 0.45 nkatÆmg
)1
lower than that of the wild-type ScMaL (520
nkatÆmg
)1
).
Characterization of the Sc(delDSGL
559
) and
Sc(L559A) mutants
The two purified MaL mutant proteins expressed in
yeast were characterized and compared with the wild-
type ScMaL. In order to determine whether the muta-
tions had affected the overall structure of the protein,
CD spectra of the Sc(delDSGL
559
) and Sc(L559A)
mutants were measured and compared with that of the
wild-type laccase (ScMaL) (Fig. 3A). The general
shapes of the spectra were the same for the Sc(del-
DSGL
559
) and Sc(L559A) mutants and wild-type
ScMaL, which suggests that no major changes in the
conformation of the mutated enzymes had occurred.
The thermal unfolding profiles measured with CD
(Fig. 3B) were broad, with no clear folded–unfolded
transition for ScMaL and the two mutants. The
Sc(L559A) mutant starts to unfold at a lower tempera-
ture as compared with ScMaL, suggesting slightly
reduced thermal stability. The difference between the
Sc(delDSGL
Effect of deglycosylation
(endo-b-N-acetylglucosaminidase F1)
on isoelectric point
One isoform, pI 4 None (one isoform), pI 4
E
o
(T1 copper center) 0.43 V 0.47 V
M. Andberg et al. Function of C-terminus in M. albomyces laccase
FEBS Journal 276 (2009) 6285–6300 ª 2009 The Authors Journal compilation ª 2009 FEBS 6289
and the Sc(delDSGL
559
) mutant, respectively. Both
mutants were expected to be stable at 25 °C, and all of
the following kinetic analyses were therefore performed
at this temperature.
The redox potential of the mononuclear (T1) copper
center for the Sc(L559A) mutant was measured using
the ferrocyanide ⁄ ferricyanide redox buffer system
(E
0,Fe
= 0.433 V) [21] in 20 mm Tris ⁄ HCl (pH 7.5).
The laccase concentration used in the redox measure-
ments was estimated from the 600 nm absorbance,
using an extinction coefficient of 5700 m
)1
Æcm
)1
. The
redox potential of the Sc(L559A) mutant was deter-
mined to be 0.43 V, which is in agreement with the
). Consequently, the
specificity constant on ABTS dropped about 10-fold
from 4.2 lm
)1
Æmin
)1
for ScMaL to 0.44 lm
)1
Æmin
)1
for the Sc(L559A) mutant. However, for the two
phenolic substrates 2,6-DMP and syringaldazine, the
L559A mutation did not greatly influence the catalytic
parameters (Table 2). The K
m
values for the
Sc(L559A) mutant on 2,6-DMP and syringaldazine
were 16 and 31 lm, and the corresponding K
m
values
for ScMaL were 11 and 37 lm, respectively. The
L559A mutation had decreased the turnover number
on syringaldazine about two-fold (k
cat
= 1263 min
)1
)
as compared with wild-type ScMaL (k
cat
= 2410
4.5 and 25 °C, and 2,6-DMP and syringaldazine activities were measured in 40 m
M MES buffer at pH 6 and 25 °C. For determination of inhi-
bition constants for the sodium azide, the enzyme was preincubated for 2 min with NaN
3
prior to addition of substrate. The K
i
value was
obtained from Dixon plots. The error in all measurements was estimated to ± 15%. ND, not determined.
ABTS 2,6-DMP Syringaldazine
ScMaL Sc(L559A) ScMaL Sc(L559A¢) ScMaL Sc(L559A)
K
m
(lM) 400 900 11 16 37 31
k
cat
(min
)1
) 1686 394 612 545 2410 1263
k
cat
⁄ K
m
(lM
)1
Æmin
)1
) 4.2 0.44 48 34.3 66 41.3
K
i
(lM) 7.9 85 29 55 ND ND
were determined using ABTS and 2,6-DMP as sub-
strates. On ABTS, both wild-type ScMaL and the
Sc(L559A) mutant had optimal activity at pH 4, but
the pH activity profile of the Sc(L559A) mutant was
more narrow than that of the wild-type enzyme, and
had shifted to the alkaline side (Fig. 4). At pH 3, the
relative laccase activity was 88% for ScMaL, whereas
for the Sc(L559A) mutant it had dropped to below
3%. On 2,6-DMP, the pH activity profile of the
Sc(L559A) mutant was similar to that of the wild-type
enzyme, the mutant having a slightly broader pH
activity in an alkaline pH range (Fig. 4).
The stability of the purified Sc(L559A) mutant was
also analyzed as a function of pH and temperature.
The Sc(L559A) mutant remained stable within the pH
range 5.5–8 after 330 h of incubation at 4 °C (data not
shown). At pH < 5, the enzyme started to lose its
activity, the residual activity being 40% at pH 5, and
5% at pH 4 after 330 h. No activity was observed at
pH 3 and pH 2 after 330 h. In addition, it was shown
that the Sc(L559A) mutant was not stable at tempera-
tures higher than 50 °C during prolonged incubations
(at pH 6). The thermal stability was clearly reduced in
comparison to ScMaL. As an example, the half-life
(T
1 ⁄ 2
) of wild-type ScMaL at 60 °C was 4.5 h, whereas
the half-life of the Sc(L559A) mutant at this tempera-
ture was only a few minutes (Table 3). The results are
consistent with the CD spectrum as a function of
(60 °C) > 10 min 4.5 h
M. Andberg et al. Function of C-terminus in M. albomyces laccase
FEBS Journal 276 (2009) 6285–6300 ª 2009 The Authors Journal compilation ª 2009 FEBS 6291
F1 (Sigma-Aldrich, St. Louis, MO, USA), which is an
enzyme suitable for deglycosylation of native proteins.
Endo-b-N-acetylglucosaminidase F1 generates a trun-
cated sugar molecule with one N-acetylglucosamine
residue remaining attached to the Asn. The effect of
deglycosylation was analysed by SDS ⁄ PAGE and
activity measurements. A single band at 90 kDa was
detected in the deglycosylated laccase samples, in con-
trast to the major band at about 100 kDa with an
additional smear of larger proteins observed for the
nontreated enzyme (Fig. S2). The removal of the gly-
cans reduced the laccase activity by approximately
5% (data not shown).
The secondary structure of the deglycosylated
ScMaL was also measured and compared with that
of the nonglycosylated ScMaL by CD spectroscopy.
The spectra of ScMaL and deglycosylated ScMaL
showed very little difference, indicating no major
changes in the protein fold (data not shown). The
thermal stability of the enzymes was also analyzed by
CD measurement. The results indicated that the ther-
mostability of the deglycosylated enzyme was slightly
improved in comparison with the glycosylated
enzyme.
The three-dimensional structure of the Sc(L559A)
mutant
In order to determine the structural effects of the
In addition, the B-value of the T2 copper was clearly
higher than the B-values of the two T3 coppers in the
trinuclear site (Table 4). This was observed in both
molecules in an asymmetric unit, thus verifying the
phenomenon. Furthermore, no electron density was
observed for the chloride ion in molecule A. A chlo-
ride ion is coordinated to the T2 copper in the wild-
type MaL [4]. In molecule B, some electron density
was observed, but the refined chloride showed a very
high B-value. On the basis of this structure solved at
2.4 A
˚
resolution, it is impossible to say whether there
is a hydroxide or chloride ion, but we decided to refine
a chloride ion, because our near-atomic resolution
structure has confirmed that MaL has a chloride ion
in this position. It is likely that the occupancy of the
chloride ion was less in molecule B and that it was
totally lost in molecule A. Therefore, it seems that the
Fig. 5. (A) 2F
o
) F
c
electron density map of the C-terminus in the
crystal structure of the Sc(L559A) mutant (Protein Data Bank code:
3KDH). (B) Superimposition of the native enzyme (Protein Data
Bank code: 2Q9O) (green) and the Sc(L559A) mutant structure (in
blue).
Function of C-terminus in M. albomyces laccase M. Andberg et al.
6292 FEBS Journal 276 (2009) 6285–6300 ª 2009 The Authors Journal compilation ª 2009 FEBS
extracted in the mononuclear site by the T1 copper and
further transferred to the trinuclear site, where dioxy-
gen acts as a terminal electron acceptor. Therefore, it is
difficult to draw any conclusions about the effect of the
C-terminal mutation on the binding of dioxygen. In
addition, it should be noted that the B-values of oxygen
atoms are very low, especially in molecule A.
Discussion
The ascomycete M. albomyces produces a thermostable
and alkaline laccase that undergoes C-terminal
processing. The processing site has been shown to be
conserved, but the C-terminal extension is not present
in all ascomycete-type laccases. The laccase sequences
from Chaetomium globosum, P. arenaria, N. crassa,
My. thermophila, Thielaviae arenaria and Magnapor-
the grisea contain the extension (Fig. 6). Processing
has been reported in the literature for only some
laccases [16–19,23]. The amino acid preceding the
C-terminal extension in the laccases undergoing
processing has been shown to be a Leu. C-terminal
processing has also been shown for the basidomycete
laccase from Coprinus cinereus, but the processing is
distinct from that of the ascomycete laccases, because
the C-terminus of C. cinereus laccase does not contain
the conserved ascomycete cleavage site [24].
The role of C-terminal processing of the ascomycete
laccases is not known, but it has been suggested to be
involved in the activation of the laccase [17,19].
Screening a My. thermophila laccase mutant library,
Zumarraga et al. found a laccase variant with better
T2 48.0 58.1 15.9 20.1 21.4 22.1 10.1 10.5
Cl 49.9 – 22.7 27.0 31.9 32.1 15.2 15.4
O1 1.0 9.9 33.2 32.0 11.2 13.8 24.4 23.9
O2 1.1 8.3 28.2 27.8 – – 26.0 25.3
M. Andberg et al. Function of C-terminus in M. albomyces laccase
FEBS Journal 276 (2009) 6285–6300 ª 2009 The Authors Journal compilation ª 2009 FEBS 6293
in My. thermophila laccase (75% identical to MaL)
resulted in a protein with disturbed T1 copper geome-
try and reduced redox potential, as well as an altered
trinuclear copper site, as shown by reduced oxygen
uptake [25]. Surprisingly, the mutations in the C-termi-
nal extension affected the protein properties, although
the extension was cleaved from the mature protein.
The mutations were suggested [25] to affect the folding
of the protein during the post-translational processing,
and thereby the function of the mature laccase.
Our structural analysis of wild-type MaL indicated
that the last four amino acids of the mature protein
penetrate the tunnel leading from the surface to the
trinuclear site and form a plug [2]. C-terminal blocking
might be a general feature of ascomycete laccases. In
fact, we have determined a low-resolution structure
(3.1 A
˚
)ofTh. arenaria laccase (unpublished results),
and it clearly shows that the C-terminus similarly
blocks the tunnel leading towards the trinuclear site.
This is strong evidence that C-terminal blocking is a
common feature of ascomycete laccases.
The deletion of the last four amino acids in MaL
559
) mutant was impossible to determine by
activity measurements. Although the thermal unfolding
profiles for the mutant and wild-type laccases were
broad, with no clear folded–unfolded transition, it was
evident that the mutants were less thermostable than
the wild-type ScMaL. However, the similarities
between the far-UV CD spectra of the mutants and
that of the wild-type ScMaL do not support any major
conformational changes of the deletion mutant. The
reduced thermostability of the Sc(L559A) mutant was
also confirmed by residual activity measurements at
different temperatures. The crystal structure of the
Sc(L559A) mutant revealed T2 copper and chloride
ion depletion in the trinuclear site. It has been
observed that the first step in the denaturation of
laccases, before actual denaturation, is the loss of one
copper atom [26]. The clearly lowered protein stability
of the Sc(L559A) mutant protein is probably due to
T2 copper depletion.
A well-known laccase inhibitor, azide, has been
shown to bind to the trinuclear site in the crystal
structure of BsL [5], thus preventing binding of oxygen.
We analyzed the azide inhibition and determined the
inhibition constants for sodium azide, in order to see
the effect of the mutation (L559A) on the binding
properties in the trinuclear center. The inhibition of
MaL by azide was determined to be mixed inhibition
in which both specific and catalytic effects are present.
Thus, azide can bind both to the free laccase and
dioxygen binding and that the depletion of the T2
copper inactivates the enzyme [13,22].
Notably, the effect of the mutation on the inhibi-
tion constant (K
i
) for azide was dependent on the sub-
strate. Similarly to the specificity constant on ABTS,
which was reduced 10-fold, the K
i
was increased
11-fold; however, the changes with the phenolic
substrates (2,6-DMP and syringaldazine) were not so
dramatic. The different behavior of the nonphenolic
ABTS and the phenolic substrates may be partly
caused by pH. When ABTS was used, kinetic analyses
were carried out at pH 4.5, whereas pH 6 was used
for the phenolic substrates. The oxidation of ABTS
does not involve proton transfer from the substrate to
the enzyme, in contrast to what occurs with the phe-
nolic substrates. When ABTS is used, many acidic
amino acids around the trinuclear site (mainly Asp
residues) can provide an immediate supply of protons
for the reduction of dioxygen. Therefore, the mutation
near the trinuclear site may have a more dramatic
impact, especially at low pH, for the nonphenolic
substrates.
Interestingly, the conformational changes in the
trinuclear site seen in the three-dimensional structure
of the mutant protein have a clear effect on the appar-
ent affinity of the substrates, as seen from increased
GCGCTTCGTGTT-3¢ and 5¢-GGGTTATGAACGGGAT
GTTT-3¢ as upstream and downstream primers, respec-
tively, and for construction of the Tr(L559G) mutant,
the primers 5¢-ACCCCAAGATCGACTGGGCGG TAAG
CGTCGCGCTGGGTGGAGGA-3¢ and 5¢-TCCTCCACC
CAGCGGCGACGCTTACCGCCCGAGTCGATCTTGG
GGT-3¢ were used as forward and reverse primers, respec-
tively. For construction of the Tr(delDSGL
559
) mutant, the
forward primer 5¢-CGAATCCCTACCCCAAGATCTGAT
CGGGCCTGAAGCGTCGCCG-3¢ and the reverse primer
5¢-CGGCGACGCTTCAGGCCCGATCAGATCTTGGGG
TAGGGATTCG-3¢ were used. Briefly, the mutagenesis
was achieved by PCR with the use of specifically designed
primers with the desired substitutions included in their
sequence. Two independent PCR reactions were carried out
with the mutagenic primer and an outer flanking primer to
produce a forward and reverse fragment. The overlapping
fragments containing the mutation were then fused together
in a subsequent PCR reaction with the outside primers.
The plasmid pLLK8 was digested with SacII and NsiI, and
a fragment coding for the wild-type MaL was removed and
replaced by the mutated fragments. The laccase mutant
clones in plasmid pLLK8 were verified by sequencing to
confirm that no other changes in the nucleotide sequence
had occurred.
Production of the the Tr(delDSGL
559
) and
)1
spent grain, 0.1 mm CuSO
4
and 10 gÆL
)1
sodium
phthalate to buffer the medium to pH 6, for 7 days at
28 °C and 200 r.p.m.
Construction of the Sc(delDSGL
559
) and
Sc(L559A) mutants for expression in S. cerevisiae
All of the mutant laccase genes were cloned into the plas-
mid vector pMS175 [16] containing the mature MaL
sequence without the presequence and prosequence and the
C-terminal extension of the native protein. The plasmid
pMS175 is built on the S. cerevisiae expression vector
pYES2 (Invitrogen, Carlsbad, CA, USA), and contains the
a-factor prepro sequence of S. cerevisiae as a secretion
sequence for improved yeast expression. The mutant laccase
genes were created with Stratagene’s (La Jolla, CA, USA)
QuickChange XL kit designed for large plasmids, according
to the manufacturer’s instructions, with 18 cycles of PCR
and transforming the PCR product to XL10 Gold ultra-
competent Escherichia coli cells. Primers (Sigma-Aldrich)
for construction of the Sc(L559A) mutant for PCR reac-
tions were as follows: forward, 5 ¢-CCAAGATCGACTCG
GGCGCTTAGCGTCGC-3¢; and reverse, 5¢-GCGACGCT
AAGCGCCCGAGTCGATCTTGG-3¢. For construction of
the Sc(delDSGL
raffinose and 1 mm CuSO
4
for 2 days (to a D
600 nm
of approximately 7) at 30 °C and 250 r.p.m. The well-grown
inoculumn (8 · 50 mL) was used to inoculate 8 · 500 mL of
fresh medium, and the cells were grown for an additional
1 day (D
600 nm
of 5–10), after which the cells were collected
by centrifugation (5000 g for 10 min), washed with one vol-
ume of sterile 0.9% NaCl solution, centrifuged again (5000 g
for 10 min), and finally suspended in induction medium (one
volume). The induction medium was similar to the inocula-
tion medium, except that 2 gÆL
)1
galactose was used instead
of 2 gÆL
)1
raffinose. After 3 days, the cells were removed by
centrifugation (5000 g for 10 min), and the clear culture
supernatant was collected and concentrated 10–20-fold by
ultrafiltration (molecular mass cut-off of 10 000 Da).
The Sc(L559A) mutant was also produced in a 20 L
laboratory-scale bioreactor. Culture was performed in
synthetic complete medium (SC-URA) buffered to pH 6 with
succinate and supplemented with 1 mm CuSO
4
. The yeast
cells were grown on glucose (40 gÆL
(Resource Q). The bound proteins were eluted with a linear
Function of C-terminus in M. albomyces laccase M. Andberg et al.
6296 FEBS Journal 276 (2009) 6285–6300 ª 2009 The Authors Journal compilation ª 2009 FEBS
Na
2
SO
4
gradient (0–300 mm). The Sc(delDSGL
559
) mutant
was further purified by hydrophobic interaction chromato-
graphy. The sample was applied to a Phenyl Sepharose FF
column pre-equilibrated with 700 mm Na
2
SO
4
in 20 mm
Tris ⁄ HCl (pH 7.5). Proteins were eluted with a 700–0 mm
Na
2
SO
4
gradient. Active fractions were concentrated and
further loaded onto a gel filtration column (Sephacryl
S-100) in 20 mm Tris ⁄ HCl (pH 7.5). Pooling of the
Sc(delDSGL
559
) mutant-containing fractions was performed
on the basis of antibody detection on dot blots. Purification
of the laccases was followed by SDS ⁄ PAGE analysis.
Æcm
)1
. The laccase activities for 2 mm
2,6-DMP and 0.06 mm syringaldazine were calculated by
measuring the oxidation of these compounds in 40 mm
MES ⁄ NaOH buffer (pH 6) at 25 °C at 469 nm
(e =19600m
)1
Æcm
)1
) and 525 nm (e =65000m
)1
Æcm
)1
)
for 2,6-DMP and syringaldazine, respectively. Activities
were expressed as nanokatals.
Kinetic constants (K
m
and k
cat
values) for the different
laccase proteins were determined using nonphenolic ABTS
(pH 4.5) and phenolic 2,6-DMP and syringaldazine (pH
6.0) as substrates at 22 °C. Eight different substrate concen-
trations (0.06–4.7 mm, 0.006–1.7 mm and 0.001–0.12 mm
for ABTS, 2,6-DMP, and syringaldazine, respectively) were
used. Kinetic measurements were performed in microtiter
plates in a total reaction volume of 300 lL. All the
measurements were performed in triplicate. The reactions
succinate buffer (pH 4.5). The pH optima of ScMaL and
the Sc(L559A) mutant on 4.7 mm ABTS and 2 mm 2,6-
DMP as substrates were determined in McIlvaine buffer
(pH 2.5–8.2) at 22 °C. The residual enzyme activities were
measured with ABTS or 2,6-DMP as substrates, as
described above.
CD spectroscopy
CD spectra were recorded on a JASCO model J-720 CD
spectrometer equipped with a PTC-38WI Peltier thermally
controlled cuvette holder. Far-UV (240–190 nm) CD mea-
surements were performed with 2 lm enzyme in 10 mm
sodium phosphate buffer (pH 7.1) at 25 °C, using a 1 mm
cell and a bandwith of 1 nm. Spectra were accumulated
four times, and the values were corrected for buffer contri-
butions. For comparison of the CD spectra, data smoothed
by the Savitzky–Golay method were normalized by calcula-
tions using the graphpad prism software.
Thermal unfolding curves were obtained by monitoring
the 202 nm ellipticity as a function of temperature. The
temperature was raised gradually at 1 °CÆmin
)1
from 30 °C
to 90 °C. For comparison of the unfolding curves, the data
measured at 202 nm were smoothed by an adjacent averag-
ing procedure, prior to normalization by graphpad prism
software.
M. Andberg et al. Function of C-terminus in M. albomyces laccase
FEBS Journal 276 (2009) 6285–6300 ª 2009 The Authors Journal compilation ª 2009 FEBS 6297
Redox titration
The redox potential of the mononuclear (T1) copper center
mutant
Crystals of the Sc(L559A) mutant were grown by the vapor
diffusion method at 20 °C, using 15% PMME2000, 0.2 m
ammonium sulfate, and 0.1 m sodium acetate buffer (pH
4.5). The protein concentration was 10 mgÆmL
)1
. Better-
quality crystals were obtained with a microseeding method
using 13% PMME2000 and an equilibrium time of
4 h. Crystals were tiny, with dimensions of about
0.1 · 0.1 · < 0.05 mm. The crystal was harvested and
plunged into the liquid nitrogen, using 25% glycerol as
cryoprotectant.
Diffraction data were collected on a beamline X12
located at the DORIS storage ring at DESY, using a wave-
length of 1.365 A
˚
. The crystal was partly nonmerohedrally
twinned, but the data-processing program xds was able to
process it rather well and the data were scaled with xscale
(Table 5). The space group was C2, with two molecules per
asymmetric unit. The structure was solved by a molecular
replacement method, using the coordinates of rMaL. The
structure was refined by iterative cycles of manual fitting
with o and positional refinements with cns. Refinements
were carried out using an initial anisotropic B-factor and
bulk solvent corrections. Data statistics are shown in
Table 5. R-values of the final model are slightly high, but
the electron density map was of good quality. The coordi-
nates and structure factors of the Sc(L559A) mutant have
) 20–2.4 (2.5–2.4)
Unique reflections 50 624 (5497)
Completeness (%) 97.4 (92.3)
R
meas
(%) 13.8 (37.9)
R
sym
11.8 (32.3)
I ⁄ I(r) 9.0 (4.0)
Refinement
Number of reflections
in working set
48 093
Number of reflections
in test set
2532
R
work
(%) 22.4
R
free
(%) 28.2
rmsd from restraint target values
Bond lengths (A
˚
) 0.0119
Angle distances (A
˚
) 1.5852
structure of a laccase from Melanocarpus albomyces
with an intact trinuclear copper site. Nat Struct Biol 9,
601–605.
3 Hakulinen N, Kruus K, Koivula A & Rouvinen J
(2006) A crystallographic and spectroscopic study on
the effect of X-ray radiation on the crystal structure of
Melanocarpus albomyces laccase. Biochem Biophys Res
Commun 350, 929–934.
4 Hakulinen N, Andberg M, Kallio J, Koivula A, Kruus
K & Rouvinen J (2008) A near atomic resolution struc-
ture of a Melanocarpus albomyces laccase. J Struct Biol
162, 29–39.
5 Bento I, Martins LO, Lopes GG, Carrondo MA &
Lindley PF (2005) Dioxygen reduction by multi-copper
oxidases; a structural perspective. Dalton Trans 7, 3507–
3513.
6 Bento I, Peixoto C, Zaitsev VN & Lindley PF (2007)
Ceruloplasmin revisited: structural and functional roles
of various metal cation-binding sites. Acta Crystallogr
63, 240–248.
7 Piontek K, Antorini M & Choinowski T (2002) Crystal
structure of a laccase from the fungus Trametes versicol-
or at 1.90-A
˚
resolution containing a full complement of
coppers. J Biol Chem 277, 37663–37669.
8 Bertrand T, Jolivalt C, Briozzo P, Caminade E, Joly N,
Madzak C & Mougin C (2002) Crystal structure of a
four-copper laccase complexed with an arylamine:
insights into substrate recognition and correlation with
cloning and expression in Saccharomyces cerevisiae of a
laccase gene from the ascomycete Melanocarpus
albomyces. Appl Environ Microbiol 70, 137–144.
17 Germann U, Muller G, Hunziker P & Lerch K (1988)
Characterization of two allelic forms of Neuros-
pora crassa laccase. Amino- and carboxyl-terminal
processing of a precursor. J Biol Chem 263, 885–896.
18 Fernandez-Larrea J & Stahl U (1996) Isolation and
characterization of a laccase gene from Podospora
anserina. Mol Gen Genet 252, 539–551.
19 Bulter T, Alcalde M, Sieber V, Meinhold P, Schlacht-
bauer C & Arnold FH (2003) Functional expression of
a fungal laccase in Saccharomyces cerevisiae by directed
evolution. Appl Environ Microbiol 69, 987–995.
20 Kiiskinen L-L, Kruus K, Bailey M, Ylosmaki E,
Siika-aho M & Saloheimo M (2004) Expression of
Melanocarpus albomyces laccase in Trichoderma reesei
and characterization of the purified enzyme.
Microbiology 150, 3065–3074.
21 Xu F, Shin W, Brown SH, Wahleithner JA, Sundaram
UM & Solomon EI (1996) A study of a series of recom-
binant fungal laccases and bilirubin oxidase that exhibit
significant differences in redox potential, substrate speci-
ficity, and stability. Biochim Biophys Acta 1292, 303–311.
22 Ducros V, Brzozowski AM, Wilson KS, Brown SH,
O
¨
stergaard P, Schneider P, Yaver DS, Pedersen AH &
Davies GJ (1998) Crystal structure of the type-2 Cu
depleted laccase from Coprinus cinereus at 2.2 A
27 Penttila
¨
M, Nevalainen H, Ra
¨
tto
¨
M, Salminen E &
Knowles J (1987) A versatile transformation system for
the cellulolytic filamentous fungus Trichoderma reesei.
Gene 61, 155–164.
28 Sherman F (1991) Getting started with yeast. Methods
Enzymol 194, 3–21.
29 Laemmli UK (1970) Cleavage of structural proteins
during the assembly of the head of bacteriophage T4.
Nature 227, 680–685.
30 Niku-Paavola M-L, Karhunen E, Salola P & Raunio V
(1988) Ligninolytic enzymes of the white-rot fungus
Phlebia radiata. Biochem J 254, 877–884.
Supporting information
The following supplementary material is available:
Fig. S1. Western blot analysis of culture supernatants
of T. reesei strains producing wild-type and mutant
MaL.
Fig. S2. SDS ⁄ PAGE of purified deglycosylated
Sc(L559A) mutant.
This supplementary material can be found in the
online version of this article.
Please note: As a service to our authors and readers,
this journal provides supporting information supplied
by the authors. Such materials are peer-reviewed and