Distribution of the lipolysis stimulated receptor in adult and
embryonic murine tissues and lethality of LSR–/– embryos
at 12.5 to 14.5 days of gestation
Samir Mesli
1
, Sandrine Javorschi
1,
†, Annie M. Be
´
rard
1
, Marc Landry
2
, Helen Priddle
3
, David Kivlichan
3
,
Andrew J. H. Smith
3
, Frances T. Yen
4
, Bernard E. Bihain
4
and Michel Darmon
1
1
Laboratoire de Biochimie et de Biologie Mole
´
culaire, Universite
´
immunofluorescence experiments s howed a s taining at the
periphery of hepatocytes as well as in fetal liver at E12 and
E15. These results are i n agreement with the assumption that
LSR is a plasma membrane receptor involved in the clear-
ance of lipoproteins by liver, and suggest a possible r ole in
steroidogenic organs, lung, i ntestine and kidney). To explore
the role of LSR in vivo,theLSR gene was inactivated in 129/
Ola ES cells by removing a gene segment containing exons
2–5, and 129/Ola-C57BL/6 m ice b earing the deletion were
produced. Although heterozygotes appeared normal, LSR
homozygotes were not viable, with the exception of three
males, while the total progeny of genotyped wild-type and
heterozygote pups was 345. Mortality of the homozygote
embryos was observed between days 12.5 and 15.5 o f ges-
tation, a time at which their liver was much smaller than that
of their littermates, indicating that the expression of LSR is
critical for liver and embryonic development.
Keywords: lipoprotein receptors; Northern-blot; quantita-
tive PCR; immunofluorescence; gene-targetting.
Lipids, absorbed exogenously by the intestine and synthe-
sized endogenously by the liver, are secreted into the
circulation as lipoproteins for their transport to tissues,
where they are used mainly for membrane synthesis,
steroidogenesis and fat storage. Dietary cholesterol, phos-
pholipids, triglycerides (TG) and fat-soluble vitamins
absorbed by the intestine after a meal are transported by
chylomicrons into lymph, then into blood. Lipoprotein
lipase (LPL), anchored to the surface of capillary endothe-
lium, hydrolyzes TG of chylomicrons into free fatty acids
(FFA) that are taken u p by the underlyi ng muscle and
´
culaire, Zone
Nord – Case 49–146, Rue Le
´
o Saignat, 33076 Bordeaux Cedex,
France. Fax: + 33 5 5 7 57 1397, Tel.: + 33 5 57 57 15 79.
E-mail:
Abbreviations: apo, apolipoprotein; FFA, free fatty acids; GAPDH,
glyceraldehyde-3-phosphate dehydrogenase; HDL, high density lipo-
proteins; LDL, low density lipoproteins; LDLR, low density lipo-
protein receptor; LRP, low density lipoprotein receptor related
protein; LSR, lipolysis stimulated receptor; SR-BI, scavenger receptor
BI; TG, triglycerides; TRL, triglyceride-rich lipoproteins; VLDL, very
low density lipoproteins.
Present address : Invitrogen C orp. 1610 Faraday Avenue, Carlsbad,
CA 92008, U SA.
(Received 1 April 2004, revised 6 May 2004, accepted 19 May 2004)
Eur. J. Biochem. 271, 3103–3114 (2004) Ó FEBS 2004 doi:10.1111/j.1432-1033.2004.04223.x
same three bands were detected. Molecular cloning of the
LSR allowed the authors to identify putative t ranslation
products of 58.3, 63.8, and 65.8 kDa. The combination of
various techniques suggested that the receptor was a
multimer of subunits associated through disulfide bridges
[5]. Several characteristics of LSR suggest that it might
represent a significant element for the clearance of TRL: (a)
LSR is able t o bind lipoproteins containing apoB and apoE;
(b) LSR displays high affinity for T RL; (c) LSR b inding is
inhibited by lactoferrin, receptor associated prote in ( RAP),
and apoCIII, all reported to have a hyperlipemic effect in
animals [2,3] [6,7]; (d) the apparent number of LSR binding
Protection (approval 04476).
Northern blots
Mouse embryo and adult multiple tissue Northern blots were
performed with nylon membranes blotted to gels loaded with
2 lg mRNA per lane (Clontech, Saint-Quentin en Yvelines,
France). They were prehybridized for 30 min at 68 °Cin
Express Hyb TM hybridization solution ( Clontech) and then
hybridized for 2 h at 68 °C with t he same solution supple-
mented with the appropriate radiolabeled cDNA probes.
The glyceraldehyde-3-phosphate dehydrogenase (GAPDH)
probe (500 bp fragment) was prepared by No tIandEcoRI
digestion o f the murin e cDNA inserted in PT7T3d plasmid
(IMAGE clone 113843, UK HGMP Resource Centre,
Cambridge, UK). The LSR probe (full length 2 kb insert)
was prepared by EcoRI digestion o f the murine cDNA
inserted in pGEMT-easy 5Zf(–) (a gift from Genset, La Jolla,
CA, USA). Probes were labeled by decanucleo tide-mediated
incorporation of [
32
P]dCTP[aP] (Ambion, Montrouge,
France). Blots were rinsed three times with 2· NaCl/Cit,
0.05% SDS at room temperature for 30 min and washed
twice with 0.1· NaCl/Cit, 0.1% SDS at 50 °Cfor40min
with agitation. Autoradiography was performed by expo-
sure for 2 h in a PhosphorImager (Molecular Dynamics,
Amersham–Pharmacia–Biotech, Orsay, France).
Real-time RT-PCR
Mouse tissues were pooled from 4 to 5 mice on a standard
diet. Samples were immediately put into Trizol (Gibco
BRL, Cergy-Pontoise, France)andstoredat)80 °C
M
sense and antisense p rimers
(except for GAPDH, 120 n
M
of each) and 200 n
M
probe in a
final volume of 25 lL using the TaqMan PCR mix (Applied
Biosystems). Relative quantitation of a given gene w as
calculated after normalization to 18S ribosomal RNA
amount for tissues from which RNAs were i solated ( liver,
ovaries, adrenal g lands, testes, intestine, brain, muscle), or
GAPDH amount for tissues for which total cDNA were
purchased (liver, lung, kidney, heart). Individual C
T
values
are means of duplicate measurements. Delta C
T
were
converted to arbitrary values with the f ormula: arbitrary
units ¼ 2
)dC
T
· 10
6
assuming an efficiency of amplification
of 100%. Results are expressed as the mean of two
experiments. The complete list of gene-specific primers
and probes can be found in Table 1 . It must be noted that
the quantitative P CR was d esigned to d etect the sum of all
i
and i ncubated w ith fluorescein-
conjugated goat anti-rabbit IgG (Molecular Probes/Inter-
chim, Montluc¸ on, France) 1 : 200 in NaCl/P
i
-BSA for 1 h at
37 °C. The sections were the n washed 3· in NaCl/P
i
before
mounting in Prolong
TM
Antifade (Molecular Probes/Inter-
chim). Slides were examined with a Leica photomicroscope
using appropriate filter systems. P hotographs were taken on
Kodak films (Amersham–Pharmacia–Biotech).
Gene targeting of the
LSR
gene and generation
of LSR deficient mice
The murine (C57BL/6) LSR gene contains 10 coding exons
with an open reading frame of 1782 nuclotide long encoding
a peptide of 594 amino acids (F. T. Yen & B. E. Bihain,
unpublished results). A129/Ola mouse genomic lambd a
2001 library was screened with a full length LSR cDNA
probe to isolate cloned DNA for the targeting v ector
construction. Several o verlapping phage clo nes, which
together covered the most part of the gene, were isolated
and inserts sequenced. This sequence (GenBank AY376636)
contained the first eight exons and ends 19 bp before the
end of exon 9 of the LSR gene; it lacks all of intron 9 and
subsequently test-crossed with C 57BL/6 females. Germline
transmission from chimeras derived with t wo independ ent
targeted clones was confirmed in agouti coat colored
Table 1. Sequences of primers and probes used for real-time PCR with the TaqMan system. NC, sequences no t communicated by Perkin Elmer.
mRNA Upstream primer (5¢fi3¢) Probe (5¢fi3¢) Downstream primer (5¢fi3¢) Amplicon size (bp)
LSR atgcgtcctccctatgggtac tggagactttgacaggaccagctcagttg acctgggagctgtggcc 71
(exons 6–7)
LDLR
X64414
ctgtccccccaagacgtg caagtgcatctccccgcagtttgtgt ccatctaggcaatctcggtctc 102
(430–531of 4467)
LRP
AF074265
gtcccattggctttgagctc tcgaggagagcggatatcagacgcatatc gccacattgttgttgtttgtttc 124
(1926–2049 of 5521)
SRB1
U37799
tgatgatgaccttggcgct caccatgggccagcgtgcttt gggaagcatgtctgggagg 131
(520–650 of 1785)
ApoB
M35186
cgtgggctccagcattcta ccaatggtcgggcactgctcaa tcatttctgcctttgcgtcc 65
(771–835 of 2354)
ApoE
D00466
attacctgcgctgggtgc tgaccaggtccaggaagagctgca gtcagttcttgtgtgacttgggag 79
(134–212 of 936 CDS)
Apo A1
X64262
gacactctgggttcaaccgttagt ctgcaggaacggctgggccc ttcctctaggtccttgttcatctcc 126
For PCR, genomic DNA from embryos and adult m ouse
tails was extracted by proteinase K digestion, isolated using
the Genomic DNA Purification Kit (Promega, Charbonnie
`
-
res, France) and p recipitated with ethanol. PCR primers
were selected to generate a product specific for either the
wild-type or the mutant LSR allele. The wild-type LSR
allele was diagnosed by a 773-bp PCR product g enerated by
a f orward primer located in e xon 4 (5¢-CAGGACC
TCAGAAGCCCCTGA-3) and a reverse primer located
in exon 5 (5¢-AACAGCACTTGTCTGGGCAGC-3¢). This
region of the LSR gene is deleted in the mutant allele. The
Fig. 1. Generation of the LSR null allele. (A) Structure of the mouse LSR gene (top), the linearized LSR targeting vector (middle) and the targeted
allele (bottom) resulting from replacement recombination. The null allele was created by deletion of a 9.8 kb in ternal region of the gene from the
beginning of exon 2 to the end of exon 5 and its substitu tion with a b-galactosidase/neomycin phosphotransferase reporter/selection cassette.
Dashed crosse s indicate the recombination cross-over positio ns between homologous vector and c hromosomal sequence. Chrom osomal and cloned
genomic DNA sequence is shown by a thick black line (for intron and flanking nonc oding sequence) and by black rectangle s (for exon sequence),
the reporter/positive selection cassette by IRES laczpA and grey (loxP/MC1neopA loxP
)1
) rectangles, the HSV thymidinekinasenegativeselection
cassette (MC1tk dimer) by a rectangle and p Bluescript plasmid sequence by a thin black line. Sites fo r HindIII restriction enzyme (H)areindicated
by small arrows and t he sizes of relevant restriction fragments in th e wild-type and targeted allele are shown by dotted lines. The targeted allele was
identified by HindIII digestion and hybridization with the 5¢-and3¢-flanking probe fragments (striped rectangles) to detect the indic ated size
fragments. (B) Southern blot analysis of Hin dIII-digested genomic DNA prepared from 96-well p lates of G418+ G ancyclovir resistant ES cell
clones derived from transfection w ith the LSR targeting vector. The digested DNA and a kHindIII marker was resolved o n a 0.6% agarose gel,
blotted to positively charged nylon membrane and hybridized with 25 ng of 3¢-probe and 25 ng of kHindIII marker. The hyb ridized blots were
exposed to Ko dak XOMAT film overnight at )80 °C. The 3¢-probe detects a 10.5 kb HindIII fragment for the w ild-type allele and a 13 kb
fragment in a targeted a llele.
3106 S. Mesli et al.(Eur. J. Biochem. 271) Ó FEBS 2004
1.35 kb GAPDH band. Data showed that testes and kidney
contained, respectively, 63% and 48% of the signal present
in liver. Figure 2 B shows a Northern blot containing
mRNA from whole embryos at stages E7, E11, E15, and
E17 hybridized with an LSR probe and reprobed with a
GAPDH cDNA. The 2.1 kb LSR band was detected at all
stages. Again, loading of the lanes w as unequal making
direct quantification difficult. As in the case of adult tissues,
we normalized LSR bands to the corresponding 1.35kb
GAPDH bands. Ratios were approximately equal at all
stages, indicating that the LSR expression level was of the
same order of magnitude between E7 and E 17.
Real-time quantitative RT-PCR
In a first selection of tissues (liver, o varies, adrenal glands,
testes, intestine, brain and muscle), LSR mRNA was
extracted as described in Materials and methods. Results
obtained by real-time quantitative RT-PCR were normal-
ized to the amount of 18S ribosomal RNA (Fig. 3A and
Table 2). Quantitative PCR was also performed on lung,
kidney and heart s amples, but in that case the starting
material was commercially available total cDNA. For those
tissues, data were normalized to the amount of GAPDH
mRNA (Fig. 3B and Table 3).
Liver c DNAs were obtained from both the mRNA
extracted in our laboratory and from the commercial source
in order to allow us to compare the two sets of experiments.
Figure 3A and Table 2 show that LSR mRNA is very
abundant in liver, as expected from t he Northern blot
analysis. We also found a significant expression in ovaries
and testes (respectively 62.8%, and 21.7% of liver), but the
(Tables 2 and 3 ) was also very different from that of LSR:
its amount in ovaries, adrenal glands, brain and muscle was
higher than that of liver (respectively 410%, 1 90%, 180%,
and 250% of the amount present in liver).
Although RT-PCR arbitrary units do not reflect
precisely tr ue message amounts , d ue to the different
amplification efficiencies for different gene targets, t aken
altoget her, the results suggest that the amount of LSR
messengers in liver is higher than that of the o ther
receptors here described. It must be noted that Fig. 3A
and B have different scales because one was normalized
to 18S ribosomal RNA and the other to GAPDH
mRNA.
Several mRNA species were used as con trols for tissue-
specific expression. As expected, prothrombin mRNA was
almost exclusively expressed in liver; apoA1 and apoB
mRNA were expressed mainly in liver but also in intestine;
apoE mRNA was predominant in liver but abundant in all
tissues; u biquitin and GAPDH mRNA were ubiquitous,
and showed important variations of expression from one
tissue to another.
The expression of LSR was also studied by quantitative
PCR during mouse embryonic d evelopment. cDNAs from
whole embryos at E7, E11, E15, E17 stages were used as
starting material and results were normalized to GAPDH
mRNAs. Figure 3C shows that LS R was d etectable at E7,
became more abundant at E11 (fourfold increase) and
maintaining these increased levels until E17. This pattern of
expression seems t o parallel liver growth as a similar t ime-
course was observed for prothrombin. Table 4 shows that in
T
· 10
6
. Liver (L), o varies (o), adrenal glands (a), testes (t), intes-
tine (i), brain (b) and muscle (m), l ung (lu), kidn ey (k) and heart (h).
E7, E11, E 15, E17: Embryo stages (days post-coitum).
3108 S. Mesli et al.(Eur. J. Biochem. 271) Ó FEBS 2004
Knock-out of the
LSR
gene
Mice with one LSR allele inactivated did not show any
detectable defect. Their size, weight, adiposity, plasma
glucose, cholesterol, triglycerides, phospholipids, nonesteri-
fied fatty acids, free glycerol, as w ell as their lipoprotein
profile were similar to those of their wild-type littermates.
Animals bearing two i nactivated LSR alleles (LSR–/–)
show an embryonic lethality between E12.5 and E15.5. As
an attempt to define the reason for the embryonic lethality
of LSR–/– embryos, timed matings were set up and
resulting embryos examined and genotyped (Table 5 and
Fig. 5). Up to E12.5, LSR–/– mice were obtained in
numbers compatible with Mendelian ratios, and macro-
scopic e xamination of t he whole litters showed that all
embryos were alive and had no observable anomalies. But
at E15.5, genotyping did not show the presence of viable
homozygote embryos. Resorbed embryos were numerous at
E14.5/15.5 and the majority were most probably LSR–/–,
but we were not able to genotype them because of DNA
degradation. At E14.5, some litters contained LSR–/–
embryos. Their only c onstant defect was a reduction in liver
.
mRNA
Tissue
Liver Ovaries Adrenal glands Testis Intestine Brain Muscle
LSR 710 446 28.5 154 298 113 3.61
LDLR 83.4 150 167 10.7 68.8 63.8 34.4
SRBI 77.8 1390 3620 89.7 16.5 95.1 43.4
LRP 22.2 91 41.7 5.5 9.8 40.6 55.8
ApoAI 244 0.79 0.04 0.06 57.1 0.04 0.06
ApoB 16900 0.3 5.5 1.5 1630 0.4 0.1
ApoE 83000 4830 7490 899 854 13900 1190
Ubiquitin 478 1840 2780 6050 343 3830 1490
Prothrombin 9490 0.5 1.8 0.4 9.8 0.1 0.8
GAPDH 1780 5910 3700 321 321 19800 51100
Table 3. Quantitation of LSR, LDLR, SR-BI, LRP, apoA1, apoB,
apoE, ubiquitin, and prothrombin by real-time PCR in a second set
of adult murine tissues. For each gene, results were normalized to
GAPDH mRNA. DC
T
were converted to arbitrary values by the
following formula: 2
)dC
T
· 10
6
.
mRNA
Tissue
Liver Lung Kidney Heart
LSR 67500 37700 7980 303
ApoA1 5.82 20.6 93.8 76.7 3380
ApoB 32 3190 25 600 5340 86 600
ApoE 12 600 30 800 277 000 578 000 1 5700 000
Ubiquitin 979 000 1 580 000 3 030 000 1 060 000 2 060 000
Prothrombin 13.6 2670 40 900 114000 901 000
Ó FEBS 2004 LSR gene and protein expression (Eur. J. Biochem. 271) 3109
from the fi rst generation, or intercrossing male and female
LSR+/– mice derived from the first generation, three viable
LSR–/– mice (all males, two from one litter, and one from
another) were obtained. They had no morphological defects
except that one of them seemed to have no testes. They were
smaller than their littermates: the 9-month weight of LSR–/–
was 30.7 ± 0.2 vs. 39.3 ± 2.1 g for their wild-type litter-
mates (P<0.02). Continual matings for 3 months demon-
strated that these mice were sterile. As one of the LSR–/–
mice died spontaneously and the others became s ick
(lethargic), we killed these two animals for necropsy and
collection of organ samples; they both showed a limited
amount of fat and one of them actually had n o testes, but no
other anatomical defect was detected. To explore whether the
genetic bac kground cou ld infl uence t he viability of LSR–/–
mice, we backcrossed the mutations in two inbred strains
(C57BL/6 and 129/Sv) and an outbred strain (MF1); we also
intercrossed heterozygotes o f C57BL/6 and 129/ Sv back-
grounds, but no viable LSR–/– mice were obtained.
Discussion
In this study, we used No rthern b lotting, real-time PCR and
immunofluorescence microscopy to examine the expression
of LSR in the adult mouse and during development. In the
adult, the highest levels of LSR expression were found in
C57BL/6 E12.5 7 1 1 4 2
C57BL6/)129/Ola E12.5 25 3 4 14 7
C57BL/6 E14.5 10 1 3 7 0
C57BL/6 E14.5 8 1 3 3 2
a
C57BL/6–129/Ola E14.5 10 1 4 6 0
MF1 E14.5 22 2 5 11 6
C57BL/6–129/Ola E15.5 13 1 7 6 0
a
Dead embryos.
3110 S. Mesli et al.(Eur. J. Biochem. 271) Ó FEBS 2004
clearance of TRL by the liver. The LDLR and the LRP
have both been shown t o be involved in t he removal of
chylomicron remnants by the liver [12,13]. The facts that
mice with an isolated inactivation of the LDLR show no
increase in circulating TG [14], and that the lack of L DLR
in humans does not lead to a pathological change in the
metabolismofdietaryfat[15]suggestthat(an)other
receptor(s) play(s) the major part in TRL clearance by the
liver. Mo reover, Rohlmann et al. [16] demonstrated that the
absence of LRP expression in the livers of LDLR-deficient
mice resulted in a large elevation in the plasma concentra-
tion of cholesterol and TG that were carried in apo B48-
containing lipoproteins resembling remnants. Nevertheless,
in LDLR-deficient mice the increase in TG levels was much
smaller than that obtained in RAP overexpression experi-
ments [17]. The authors concluded that the most probable
explanation is t hat RAP-sensitive receptors suc h as LSR [7]
could be involved in TRL clearance. Actually, our real-time
PCR data indicate that in liver, LSR mRNA is expressed
can be attributed to liver organogenesis which follows a
similar time-course [20]. Moreover, LSR protein was
detected by immunofluorescence in dissected fetal livers of
E12 and E15 mice. Although our real-time PCR data show
that all lipoprotein receptors tested follow r oughly similar
time-courses between E11 and E17, LSR and LDLR are
probably the on ly receptors, among those tested to b e
present in fetal liver in substantial amounts. Actually
previous reports show that (a) the LDLR is present in rat
liver from E19 fetuses at 19% of the adult level; (b) hepatic
LRP is still low at 1 9 days of gestation (only 6% of the adult
level) [21] and (c) SR-BI is not detectable in embryonic liver
until stage E17 [22]. The increased SR-BI mRNA synthesis
that we observed between E11 and E15 is probably due to
adrenal gland organogenesis [22]. Fetal liver has been shown
to synthesize and export into t he fetal circulation about one-
half of the cholesterol required f or heart, lung and kidney
development [21, 23]. The early e xpression of LSR in fetal
liver sugge sts that this receptor could play a role in the
uptake of lipoproteins during embryogenesis, a process that
cannot be effected by SR-BI at this stage [22]. The scarcity
of LSR messages at E7 contrasts with t he high expression at
that stage o f t he other lipoprotein receptors which are
involved in exchanges between the embryo and extraem-
bryonic an d maternal tissues. For example, SR-BI present
on the apical surfaces of visceral endodermal is thought to
provide cholesterol to extraembryonic cells for s torage until
it can be subsequently transferred to the embryo [22].
Whatever the importance of LSR for post-implantation
embryo viability, it must be noted that the abundance of its
result in embryonic lethality by various mechanisms
[28,29].
We found transcripts for all the lipoprotein r eceptors
tested, including LSR, in steroidogenic organs such as
adrenal glands, testes and ovaries. This is in agreement with
results showing SR-BI to be highly expressed in steroido-
genic tissues [30,31] which are the sites of the h ighest s pecific
activity for selective HDL cholesterol uptake in rodents [32].
Nevertheless, LSR and SR-BI were expressed differently,
more in reproductive organs than in a drenal glands fo r
LSR, and inversely for SR-BI. The specific abundance of
LSR mRNA in testes suggests that this receptor c ould play
an important role in this organ. However its implication in
steroidogenesis is questionable a s SR-BI, which has also
been detected in testes, seems to mediate phagocytosis of
apoptotic spermatogenic cells by Sertoli cells after recogni-
tion of surface phosphatidylserine [33,34]. In ovaries and
Fig. 6. Gross morphology and liver histology of
atypicalLSR–/– mutant embryo compared to
a wild-type littermate. Lateral views of
E14.5 embryos (A,B). The LSR–/– embryo
(A) shows a reduction of liver size (white
arrow) and displays hemorrhages (black
arrow) contrasting w ith an anemic color. I t
also shows a detachment of dorsal skin ( small
arrows). The wild-type littermate (B) sh ows a
liver of normal size (white arrows); its skin has
a pinkish hue, distinct subcutaneous vessels
and does not show detach ment. Note that the
overall development of the mutant is not dif-
[40], LRP and gp330/megalin [41,42], are present on alveolar
cells and a re able to bind lipoproteins and to participate to
surfactant synthesis. Moreover there is evidence that V LDL
in the presence of lipoprotein lipase (LPL), provide the free
fatty acid substrate required for surfactant synthesis [43].
LDL and HDL are also taken up by alveolar cells [40]. It is
possible t hat LSR, along with the above-mentioned recep-
tors, participates in surfactant synthesis.
LSR mRNA was found to be relatively abundant in
kidney (12% of liver levels). Immunohistochemistry indica-
ted that LSR protein was localized in glomeruli. Glomerular
cells exhibit both VLDL receptors and LDLR [44] and are
known t o be able to take up LDL via apoB/E receptors [45].
Moreover, several pathological disorders are accompanied
by lipid deposition into glomeruli [46]. The presence of LSR
in glomerular cells might provide an additional pathway for
explaining lipoprotein uptake in normal and pathological
glomerular cells.
The abundance of LSR in fetal and adult liver as well as
in steroidogenic organs and organs such as l ung or kidney
adds further evidence to its hypothesized function in lipid
transport in these organs. Unfortunately, the scarcity of
viable LSR–/– adult mice did not allow us to obtain
definitive information on the role of LSR in lipid and
lipoprotein metabolism. The p roduction of a c onditional
knock-out will be necessary t o explore this question.
Further studies are also required to u nderstand the mech-
anisms of liver involution and l ethality in LSR–/– embryos
and its relationship ( if any) with the r ole of LSR as a
lipoprotein receptor.
Inhibitory effects of specific apolipoprotein C-III isoforms o n the
binding of triglyceride-rich lipoproteins to the lipolysis-stimulated
receptor. J. Biol. C hem. 272, 31348–31354.
7. Troussard, A.A., Kh allou, J., M ann, C.J., Andre, P., Stricklan d,
D.K., Bihain, B.E. & Yen, F.T. (1995) Inhibitory effect on the
lipolysis-stimulated receptor of the 3 9-kD a receptor-associate d
protein. J. Biol. Chem. 270, 17068–17071.
8. Nehls, M., Kyewski, B., Messerle, M., Waldschutz, R., S chud-
dekopf, K., Smith, A.J. & Boehm, T. (1996) Two genetically
separable steps in the differentiation of thymic epithelium. Science
272, 886–889.
9. Smith, A.J., De Sousa, M.A., K wabi-Addo, B., Heppell-Parton,
A.,Impey,H.&Rabbitts,P.(1995)Asite-directedchromosomal
translocation induced in embryonic stem cells by C re-loxP
recombination. Nat. Genet. 9, 376–385.
10. Mansour, S.L., Thomas, K. R. & Capecchi, M.R. (1988) Disrup-
tion of the proto-oncogene int-2 in mouse embryo-derived stem
cells: a general strategy for targeting mu tations to non-se lectab le
genes. Nature 336, 348–352.
11. Smith, A.G. (1991) Culture and differentiation of embryonic stem
cells. J. Tiss. Cult. Meth. 13, 89–94.
12. Willnow, T.E., G oldstein, J .L., Orth, K., Brown, M.S. & H erz, J.
(1992) Low density lipoprotein receptor-related protein and gp330
bind similar ligands, including plasminogen activator-inhibitor
complexes and lactoferrin, an inhib itor of chylomicron remn ant
clearance. J. Biol. C hem. 267, 26172–26180.
13. Choi, S.Y. & Cooper, A.D. (1993) A comparison of the roles of
the low density lipoprotein (LDL) receptor and the LD L receptor-
related protein/alpha 2-macroglobulin receptor in chylomicron
remnant removal in the mouse in vivo. J. Biol. C hem. 268, 15804–
J. Lipid Res. 36, 641–652.
22. Hatzopoulos, A.K., Rigotti, A., Rosenberg, R.D. & K rieger, M.
(1998) Tempo ral and spatial pattern of expression of the HDL
receptor SR-BI during m urine embryogenesis. J. Lipid Res. 39 ,
495–508.
23. Jurevics, H.A., Kidwai, F.Z. & Morel l, P. ( 1997) Sources o f
cholesterol during development of the rat fetus and fetal organs.
J. Lipid Res. 38, 723–733.
24. Staels, B., Jansen, H., van Tol, A., Stahnke, G., W ill, H., Verho-
even, G. & Auwerx, J. (1990) Development, food intake, and
ethinylestradiol influence hepatic t riglyceride lipase and LD L-
receptor mRNA levels in rats. J. Lipid Res. 31, 1211–1218.
25. Spijkers, J.A., van den Hoff, M.J., Hakvoort, T.B., Vermeulen,
J.L., Tesink-Taekema, S. & Lamers, W.H. (2001) Fetal rise in
hepatic enzymes follows decline i n c-met and hepatocyte growth
factor expression. J. Hepatol. 34, 699–710.
26. Ji,M.Y.,Lee,Y.C.,Kim,K.S.,Cho,J.W.,Jung,K.Y.,Kim,C.H.
& Choo, Y.K. (1999) Developmental patterns of GalBeta1,3 (4)
GlcNAc alpha2,3-sialyltransferase (ST3Gal III) expression in the
mouse: in situ hybridization u sing DIG-labeled RNA probes.
Arch.Pharm.Res.22, 243–248.
27. Morris, S.M. Jr, Kepka, D.M., Sweeney, W.E. Jr & Avner, ed.
(1989) Abundance of mRNAs encoding urea cycle enzymes in
fetal and neonatal mouse liver. Arch. Bioch em. Biophys. 269 , 175–
180.
28. Willnow, T.E., Hilpert, J., Armstrong, S.A., Rohlmann, A.,
Hammer, R.E., Burns, D.K. & Herz, J. ( 1996) Defective fore brain
development in mice lacking gp330/megalin. Proc. Natl Acad. Sci.
USA. 93, 8460–8464.
29. Herz, J., Clouthier, D.E. & Hammer, R.E. (1992) LDL receptor-
37. Hwang, J. & Menon, K.M. (1983) Characterization of low density
and high density lipoprotein receptors in the rat corpus luteum and
regulation by gonadotropin. J. Biol. Chem. 258, 8020–8027.
38. Murata, M., Tamura, A., Kodama, H., Hirano, H., Takahashi, O.
& Tanaka, T. (1998) Possible involvement of very low density
lipoproteins i n steroidogenesis in the human o vary. Mol. Hum.
Reprod. 4, 797–801.
39. Kolleck,I.,Witt,W.,Wissel,H.,Sinha,P.&Rustow,B.(2000)
HDL and vitamin E in plasma an d the expression of SR-BI o n
lung cells during rat per inatal development. Lung 178, 191–200.
40. Voyno-Yasenetsk aya, T.A., Dobbs, L.G., Erick son, S.K. &
Hamilton, R.L. (1993) Low density lipoprotein- and high density
lipoprotein-mediated s ignal transduction and exocytosis in
alveolar type II cells. Proc. Natl A cad. Sci. USA. 90, 4256–4260.
41. Kolleck, I., Wissel, H., Guthmann,F.,Schlame,M.,Sinha,P.&
Rustow, B. (2002) HDL-holoparticle uptake by alveolar type II
cells: effect of vitamin E status. Am.J.Respir.CellMol.Biol.27,
57–63.
42. Stefansson, S., Kounnas, M .Z., Henkin, J., Mallampalli, R.K.,
Chappell, D.A., Strickland, D.K. & Argraves, W.S. (1995) gp330
on type II pneumocytes m ed iates endocytosis leadin g to
degradation of pro-urokinase, plasminogen activator inhibitor-1
and urokinase-plasminogen activator inhibitor-1 complex. J. Cell
Sci. 108, 2361–2368.
43. Mallampalli, R.K., Salome, R.G., Bowen, S.L. & Chappell, D.A.
(1997) Very low density lipoproteins stimulate surfactant lipid
synthesis in vitro. J. Clin. Invest. 99, 2020–2029.
44. Quaschning, T., Koniger, M., Kramer-Guth, A., Greiber, S.,
Pavenstadt, H., Nauck, M., Schollmeyer, P. & Wanner, C. (1997)
Receptor-mediated lipoprotein uptake by human glomerular cells: