Báo cáo Y học: Unique structural determinants in the signal peptides of ‘spontaneously’ inserting thylakoid membrane proteins - Pdf 11

Unique structural determinants in the signal peptides
of ‘spontaneously’ inserting thylakoid membrane proteins
Christophe Tissier, Cheryl A. Woolhead and Colin Robinson
Department of Biological Sciences, University of Warwick, Coventry, UK
A series of thylakoid membrane proteins, including PsbX,
PsbY and PsbW, are synthesized with cleavable signal pep-
tides yet inserted using none of the known Sec/SRP/Tat/
Oxa1-type insertion machineries. Here, we show that,
although superficially similar to Sec-type signal peptides,
these thylakoidal signal peptides contain very different
determinants. First, we show that basic residues in the
N-terminal domain are not important, ruling out electro-
static interactions as an essential element of the insertion
mechanism, and implying a fundamentally different target-
ing mechanism when compared with the structurally similar
M13 procoat. Second, we show that acidic residues in the
C-domain are essential for the efficient maturation of the
PsbX and PsbY-A1 peptides, and that even a single substi-
tution of the )5 Glu by Val in the PsbX signal peptide
abolishes maturation in the thylakoid. Processing efficiency
is restored to an extent, but not completely, by the highly
hydrophilic Asn, implying that this domain is required to be
hydrophilic, but preferably negatively charged, in order to
present the cleavage site in an optimal manner. We show that
substitution of the PsbX C-domain Glu residues by Val leads
to a burial of the cleavage site within the bilayer although
insertion is unaffected. Finally, we show that substitution of
the Glu residues in the lumenal A2 loop of the PsbY poly-
protein leads to a block in cleavage on the stromal side of the
membrane, and present evidence that the PsbY-A2 signal
peptide is required to be relatively hydrophilic and unable to

SRP and FtsY (reviewed in [12]). This is perhaps unsur-
prising as chloroplasts are widely accepted to have evolved
from endosymbiotic cyanobacteria.
Other thylakoid membrane proteins are inserted by a
different pathway that contrasts markedly with the highly
complex SRP-dependent pathway. The proteins PsbX,
PsbW, CFoII and PsbY are synthesized with N-terminal
bipartite presequences in which the first domain specifies
import from the cytoplasm across the chloroplast envelope,
after which it is removed by a stromal processing peptidase.
The second domain resembles typical ÔsignalÕ peptides,
containing three distinct domains: an N-terminal charged
region (N-domain), hydrophobic core region (H-domain)
and more polar carboxyterminal region (C-domain) ending
with an Ala-Xaa-Ala consensus region. Signal peptides
usually specify translocation by Sec-type translocation
systems in the endoplasmic reticulum, bacterial plasma
membrane or thylakoid membrane, and have been studied
in detail in these systems (reviewed in [13,14]). However,
these thylakoid proteins have been shown to insert into the
thylakoid membrane in the absence of SRP, SecA, nucleo-
side triphosphates or (dpH, thereby excluding all the ÔassistedÕ
modes of insertion into thylakoids reported to date [15–17].
Furthermore, proteolysis of thylakoids destroys the mem-
brane-bound Sec and twin-arginine translocase machineries
but has no effect on the insertion of these proteins [18]. In
the absence of identifiable translocation factors it has been
suggested that these proteins insert spontaneously into the
thylakoid membrane. A similar mechanism was originally
proposed for M13 procoat, which is also synthesized with a

hydrophobic signal peptide has been shown to be essential
inthecaseofCF
o
II [21] but the important features within
this class of signal peptide have not been studied in any
systematic manner and, because Sec- and Tat-type signal
peptides interact with proteinaceous binding sites, it is
possible that these thylakoid signal peptides may possess
unique characteristics that are essential for their correct
functioning. In this study we have analyzed the importance
of charged residues in the insertion and proteolytic
processing of PsbX, PsbW and PsbY. We show that basic
residues in the N-domain are not important for either
process whereas acidic residues in the C-domains of several
of the signal peptides play important roles in the processing
of precursor forms to the mature size. These requirements
are completely unlike those of M13 procoat, which also
bears a signal peptide, or the Sec-type signal peptides of
translocated proteins.
MATERIALS AND METHODS
Construction and expression of truncated pre-PsbW
proteins
A cDNA clone encoding the precursor form of Arabidopsis
PsbW, pPsbW [16] was amplified using inverse PCR to
generate intermediate-size and ÔshortÕ (see Results section)
versions truncated at the N-terminus (iPsbW and sPsbW).
For iPsbW, the forward and reverse primers were ATGGG
TAAGAAGAAGGGAGGA and TCTCTTTGCTCGGA
CGCG, respectively. For sPsbW, the forward and reverse
primers were ATGGAGACAAAGCAAGGAAAC and

M
sorbitol) and further incubated.
Sonication studies were carried out using a Branson 1210
water bath sonicator at 0 °C. Thylakoid import reactions
were carried out as in [16], after which samples were
analyzed immediately or after washing twice with 1 mL
20 m
M
Hepes/KOH, 5 m
M
MgCl
2
.
RESULTS
Electrostatic interactions are not essential in the early
stages of the PsbW insertion process
Studies on M13 procoat (reviewed in [12]) have demonstra-
ted the importance of electrostatic interactions between
basic residues in the protein and the negatively charged
membrane surface. These data indicated that basic residues
were essential in both the extreme N-terminal region of the
signal peptide and the C-terminal region of the mature
protein. Removal of either set of charges led to a block in
insertion, strongly indicating that the electrostatic interac-
tions were required during the early stages of the insertion
process, probably to bind the protein stably to the
membrane surface. pPsbW resembles procoat in several
respects, as detailed above, and similarly forms a loop
intermediate during insertion [20] but the early stages of the
insertion process are poorly understood and it is unclear

face [25], maturation is clear evidence of insertion and
Fig. 1B shows that all of the proteins insert into pea
thylakoids and become processed to the mature size. The
truncated proteins insert with slightly lower efficiencies
(sPsbW insertion efficiency is down to 45% of that of wild-
type protein) but the truncations, clearly, by no means block
insertion. It should be noted that even the sPsbW form still
carries a single positive charge at its N-terminus, due to the
protonated amino group. Nevertheless, we conclude that
electrostatic interactions are not as important for PsbW
insertion as for procoat insertion.
The translocated loop regions of spontaneously-inserting
proteins contain negative charges in either the mature
protein or the signal peptide
Four thylakoid membrane proteins have been shown to be
synthesized with cleavable signal peptides but inserted by
spontaneous mechanisms, and comparison of the translo-
cated loop regions shows that they are all negatively charged
(Fig. 2A). In the cases of PsbW and CF
o
II, the charges lie in
the N-terminal region of the mature protein, but PsbX
differs in that two Glu residues are located in the C-terminal
region of the signal peptide. The polyprotein, PsbY, also
contains acidic residues in this region of each signal peptide.
Other types of signal peptide (e.g. those specifying Sec-
or Tat-dependent translocation) rarely contain negative
charges in the C-terminal region and we considered it
possible that this feature may have evolved in the PsbX/
PsbY signal peptides in order to enhance the overall

regions in the signal peptides and mature protein are shown under-
lined. The sequence of the wild-type protein (WT) is given at the top;
the )5and)2 (relative to TPP cleavage site) Glu residues targeted for
mutagenesis and the nomenclatures of the mutants reflect the residues
present at these positions. The efficiency of cleavage by TTP is given in
the right hand column, calculated according to the ratio of interme-
diate: mature protein in the total chloroplast samples (lanes C in Figs 3
and 4).
Fig. 1. N-terminally truncated pPsbW constructs insert into isolated
thylakoids. (A) The primary sequence of Arabidopsis thaliana pPsbW is
shown, starting from Leu31. The TPP cleavage site is denoted by an
asterisk and the hydrophobic regions in the signal peptide and mature
protein are underlined. Note that the site of cleavage by stromal pro-
cessing peptidase is not known. Basic residues in the N-terminal region
of the signal peptide are shown in bold, as are a series of five acidic
residues in the extreme C-terminal region of the mature protein. Shown
underneath the pPsbW sequence are the truncated presequences of an
intermediate-size PsbW construct (iPsbW) and a shortened construct
lacking all basic residues in the signal peptide (sPsbW). (B) pPsbW,
iPsbW and sPsbW were synthesized in vitro by transcription–transla-
tion (lanes Tr) and incubated with isolated pea thylakoids. After
incubation, samples were analyzed of the thylakoids either directly
(lanes T) or after washing as detailed in Materials and methods (lanes
W). The mobility of mature-size PsbW is indicated by open arrowhead,
precursor forms by closed arrows.
Ó FEBS 2002 Signal peptides of thylakoid membrane proteins (Eur. J. Biochem. 269) 3133
made a mutant in which both were substituted by Val. The
import and sorting characteristics of this mutant, PsbX/VV,
and wild-type PsbX were analyzed by incubating the
precursor proteins (PsbX/VV and pPsbX, respectively) with

samples, which require protease treatment and, in the case
of the stroma/thylakoid samples, fractionation after lysis).
This was confirmed by time-course analyses, which show
gradual conversion to the mature size (data not shown;
similar examples are shown below). The presence of Val at
the )2 position thus slows down maturation to a consid-
erable extent, but does not block it. In contrast, the final
panel in Fig. 3 shows that substitution of the )5GlubyVal
(PsbX/VE) completely blocks maturation as found with the
double Val mutant.
The imported PsbX mutants described in Fig. 3 are
found exclusively in the thylakoid fraction which suggests
that insertion has taken place. However, to confirm this
point we carried out urea washes of the thylakoids because
this procedure is highly effective at removing extrinsic
membrane-associated proteins [19,24]. Figure 4 shows that
this procedure is sufficiently harsh to remove even some of
the fully inserted mature size wild-type PsbX, because some
is found in the supernatant fraction (lane Sn) after the
extraction procedure. This is apparently because single-span
proteins are more easily removed from the thylakoids by
urea [19]. However, most of the mature-size PsbX is found
in the membrane pellet fraction (lane pel) and the same
applies to the intermediate size iPsbX/VV, which is equally
resistant to extraction. As with the double Val mutant, urea
washes confirmed that the imported mature-size single-Val
mutants are fully integrated into the thylakoid membrane
(data not shown). Accordingly, we propose that the protein
cannot be cleaved by TPP, and this could be due to one of
two reasons: first, the processing site may have been altered

M
urea
and samples analyzed of the supernatant (Sn) and pellet (Pel) fractions.
Other symbols as in Fig. 3.
3134 C. Tissier et al. (Eur. J. Biochem. 269) Ó FEBS 2002
ively, according to whether the first or second Glu is
substituted by Asn, and the double mutant is PsbX/NN.
Import assays using the EN and NE single mutants are
shown in the upper panel of Fig. 5. As with the other
mutants analyzed in this study, these proteins are efficiently
imported and targeted to the thylakoid membrane. No
stromal intermediates are present and the thylakoid-associ-
ated proteins are as resistant to urea-extraction as authentic
PsbX (not shown). These data indicate that the mutations
have no detectable effect on insertion efficiency. Both
mutants are also processed to the mature size but it is
notable that maturation is not as efficient as for the wild-
type protein. Whereas PsbX is invariably found almost
exclusively as the mature form after import into chloro-
plasts, the intermediate-size forms of both single-Asn
mutants are apparent in the thylakoid fractions indicating
an inhibitory effect on maturation by TPP.
This effect is exacerbated in the PsbX/NN mutant that
contains Asn at both the )5and)2 positions. In this case,
a much greater proportion of the imported protein is
present as the intermediate form (iPsbX/NN) at the end of
the import/fractionation procedure. In this experiment we
also carried out a time-course analysis in which the PsbX/
NN mutant and wild-type pPsbX were imported for
10 min, after which the chloroplasts were washed to

position and it is unlikely in the extreme that valine should
pose a problem. In general, the important determinants for
TPP cleavage appear to be short-chain residues at the )3
and )1 residues [28], and a helix-breaking residue is also
commonly found in the region of )4to)6. Other signal
peptidases exhibit broadly similar preferences [29].
In a second line of investigation, we analyzed the
positioning of the translocated loop regions of several PsbX
derivatives, by comparing their sensitivities to digestion by
elastase (Fig. 6). The experiment involved importing wild-
type PsbX (which is cleaved exclusively to the mature size)
and three mutant forms. The first mutant (PsbX/A74T)
contains threonine at the )1 position in place of alanine and
previous studies on this mutant [20] showed that this
mutation has no effect on insertion efficiency but cleavage
by TPP is blocked, leading to the formation of a loop
intermediate with the TPP site exposed on the lumenal side
of the membrane. The other two mutants analyzed were
PsbX/NN, which has a reduced rate of maturation and
PsbX/VV, which is completely blocked in maturation. The
aim here was to determine whether this block was due to
alteration of the TPP site, such that the peptidase can no
longer cleave, or inaccessibility of the site. Control tests
(Fig. 6A) confirmed that all of these proteins are sensitive to
elastase when not inserted into membranes; elastase cleaves
pPsbX to yield a primary degradation product (denoted by
Fig. 5. Asn can partially compensate for the
absence of Glu at the )5 and )2 positions. (A)
PsbX/NE, PsbX/EN and PsbX/NN were
imported into pea chloroplasts and the

protease efficiently cleaves the intermediate to a product of
similar mobility to the mature protein, indicating that the
loop region is exposed to the lumen. The PsbX/NN mutant
behaves similarly; most of the protein is of mature-size by
the end of the experiment but the intermediate is again
resistant to proteolysis in the absence of sonication but
sensitive when sonicated. In contrast, the PsbX/VV mutant
is almost totally resistant to digestion under all conditions
and only a very minor proportion is cleaved when the
sample is sonicated. The loop region is thus inaccessible to
elastase on either side of the membrane and must therefore
be buried in the bilayer to a much greater extent than is the
case with the wild-type protein.
Acidic residues are important for efficient processing
of the PsbY polyprotein
PsbY is an unusual protein that is synthesized with two
cleavable signal peptides [23]. After insertion into the
thylakoid membrane, TPP cleaves twice on the lumenal
face to release the two signal peptides and an unidentified
protease cleaves on the stromal face of the membrane to
complete the process and generate the two single-span
mature proteins, denoted A1 and A2 [30]. Mutagenesis
studies [31] have clearly demonstrated that the cleavage on
the stromal face occurs at a late stage in the overall insertion
process. As shown in Fig. 7, both of the signal peptides (SP1
and SP2) contain acidic residues in the C-domain, and the
A2 loop also contains Glu at the +3 residue, relative to the
cleavage site. We tested the importance of these residues by
substituting the A1 Glu with Val (PsbY-A1/V) and both A2
Glu residues with Val (PsbY-A2/VV); the precise structures

andthenfurtherincubatedfor30minonice(lanesT-son).ÔIntÕ
denotes intermediate form of protein, asterisk denotes elastase degra-
dation product. Lanes Tr: translation products.
3136 C. Tissier et al. (Eur. J. Biochem. 269) Ó FEBS 2002
The import data using the PsbY-A1/V mutant are shown
in Fig. 8A. In the control import using wild-type pPsbY
(left hand panel), the precursor protein is imported and
converted to a close doublet of mature A1 and A2 proteins,
as found previously [23,31]. The PsbY-A1/V mutant is also
targeted to the thylakoid membrane and the appearance of
the A2 protein is unaffected. However, the A1 protein is
apparent in the thylakoid sample analyzed at the end of the
import/fractionation procedure (lane T) but is present in
low amounts in the chloroplast samples (lanes C and C+).
Instead, two larger intermediates are present (denoted ÔintsÕ).
These polypeptides were found to accumulate when the
processing of A1 was blocked in an earlier study [30] in
which alteration of the )1 residue was shown to block
cleavage by TPP. This suggests that the presence of the
valine in PsbY-A1/V has likewise slowed down processing
by TPP. We suspected that the near-absence of the
intermediate bands in the thylakoid sample (lane T) may
result from slow but continuing cleavage by TPP during the
course of the experiment (as described earlier). This is
confirmed in Fig. 8B, which shows time-course analyses
similar to that described above for the PsbX/NN mutant.
After a 15-min import incubation the chloroplasts were
washed to remove nonimported protein and the organelles
were further incubated for the times (in min) shown above
the lanes. The import reaction using wild-type pPsbY shows

Fig. 9. Glu fi Val substitutions near the A2 processing site blocks
cleavage of the A1 signal peptide. (A) PsbY-A2/VV was imported into
chloroplasts and the organelles were fractionated and analyzed as
detailed in Fig. 8A. Lane ÔConÕ shows the chloroplast fraction from a
control import carried out with wild-type pPsbY. The mobilities of the
A1 and A2 proteins are indicated, together with an intermediate form
of the A1 protein (A1-int). (B) The left hand panel shows the import
characteristics of a pPsbY mutant (A2-met) in which the A2 methi-
onine is replaced by leucine. The panel shows translation products
(lanes Tr) carried out using [
3
H]leucine (leu) or [
35
S]methionine (met)
and the chloroplast samples after import of each of these labeled
polypeptides (lanes ÔimpÕ, with the identity of the radiolabel indicated
below). The right hand panel shows identical analyses of the PsbY-A2/
VV mutant carried out with these radiolabeled amino acids.
Ó FEBS 2002 Signal peptides of thylakoid membrane proteins (Eur. J. Biochem. 269) 3137
However, it was deemed important to verify this point,
firstly because this result was completely unexpected, but
also because we considered it possible that both the A1 and
A2 bands may have shifted in the gel due to complex effects
arising from the mutations. We therefore used alternative
means to identify the A1- and A2-containing proteins
unambiguously. Analysis of the protein sequence (see
Fig. 7) reveals that the A1 and A2 mature proteins each
contain a single methionine towards the C-terminus of the
peptide (shown underlined and italicized). The methionine
at the end of A2 was substituted with leucine in both wild-

S]methionine-labeled sample,
while the A1int band is still present. This result confirms
that the double valine substitution in the A2 cleavage site
region does not actually affect cleavage of A2, but instead
leads to a complete block in the processing of A1 to the
mature size. The A1int polypeptide is too small to contain
three transmembrane spans (the three-span intermediates
are characterized in [28]) and, because cleavage on the
stromal surface is known to occur last and the A1 TPP
cleavage site is completely unaffected, this polypeptide
almost certainly comprises A1 plus the A2 signal peptide.
DISCUSSION
Previous studies have shown that a series of thylakoid
membrane proteins are synthesized with cleavable signal
peptides, yet are inserted by mechanisms that do not rely
on any of the known translocation machinery, either in the
soluble phase or at the membrane surface. It has been
suggested that these signal peptides provide an additional
hydrophobic region that helps to drive the insertion
process, perhaps through the formation of a Ôhelical
hairpinÕ that might provide the required driving force to
flip the N-terminus of the mature protein across the
thylakoid membrane. Intriguingly, these signal peptides
resemble those of Sec-dependent lumenal proteins to a
marked degree, and one of this class of signals can even
function as a Sec-type signal for a lumenal passenger
protein in chloroplasts [21]. However, the data shown here
point to defining features in some of these peptides that are
essential for their correct functioning and which are not
apparent in other forms of signal peptide. Our data also

not require the homologous Alb3 protein [19]. We have now
shown that these proteins differ in the means by which they
initiate insertion; electrostatic forces play a central role in
the early stages of the procoat insertion mechanism [12]
whereas pPsbW contains no basic residues in the C-terminal
region and our data show that basic residues in the
N-terminal region are not important for insertion into
thylakoids. pPsbW must therefore interact with the thylak-
oid membrane by other means. Basic residues in the
N-domain are also highly important for the functioning of
Sec-type signal peptides, possibly to promote interaction
with anionic phospholipids or SecA [13,32,33], and it
therefore appears that the signal peptides of these Sec-
independent thylakoid proteins function in fundamentally
different ways, despite the superficial similarities.
The other studies on PsbX and PsbY focused on the
C-domain, prompted by the presence of acidic residues in
this region. Acidic residues are not important in any of the
domains within Sec-type signal peptides and are generally
uncommon, especially in the C-domain which is generally
five or six residues in length and polar but uncharged [13]. In
contrast, our results point to an important function for
acidic residues in the translocated regions of these Sec/SRP/
Alb3-independent thylakoid membrane proteins. In some
cases (e.g. CF
o
II) the extreme N-terminus of the mature
protein is highly negatively charged, and we believe that
additional acidic residues in the signal peptide are probably
unnecessary. In other cases (for example PsbX and PsbY-

of this mutant is again significantly impaired although not
tothesameextentasinsomeofthePsbXmutants.
These studies are reminiscent of some observations made
with Sec-type signal peptides [34–36], where alteration of the
C-domain or H/C boundary can also affect processing by
signal peptidase. However, in the vast majority of these
cases, processing was not blocked but rather occurred
elsewhere, or the mutations made were far more drastic than
those generated in PsbX. It should be emphasized that a
near-complete block in processing occurred after only a
single substitution ()5 Glu to Val) and processing is
drastically affected in the PsbX/NN mutant despite the
presence of a highly polar C-domain of the correct length.
Overall, these mutations have far more drastic consequences
than similar mutations made in Sec-type signal peptides,
and we conclude that this may be due to one or both of the
following reasons: (a) our studies are on membrane proteins
rather than hydrophilic translocated proteins, and the
cleavagesiteregionmaythereforebemorehighlycon-
strained in the membrane because the mature protein is not
pulled across the bilayer; and/or (b) the unusual lipid
composition of the thylakoid membrane (primarily galacto-
lipid rather than phospholipid [37]) may require that the
translocated loop is more effectively presented to the signal
peptidase when acidic residues are present, for unknown
reasons.
The third aspect of this study concerned the PsbY-A2
signal peptide, but very different results were obtained in
this case. Here, the substitution of two Glu residues in the
translocated loop by Val does not block cleavage by TPP,

cleave at either site first but for simplicity it is shown as
cleaving at the SP1-A1 site. This releases SP1 which is
rapidly degraded.
Stage 2. TPP cleaves at the SP2-A2 site, releasing A2 as a
single-span mature protein and generating the A1-SP2
intermediate (Stage 2).
Stage 3. SP2 is now far more flexible, either because it is no
longer tethered at the lumenal face by charged residues or
because it is not bound to its partner polypeptide region,
A2. The stromal loop region is more accessible and cleavage
in this loop can now occur.
One possibility is that this final cleavage can only
occur when the A1 and SP2 regions are unconstrained
by cognate partner polypeptide regions (A1-SP1,
A2-SP2). First, the PsbY-A2V mutant can be cleaved
at both positions by TPP but the A1-SP2 intermediate
accumulates as a stable species (see lower panel of
Fig. 10). In our view, this is most likely because the SP2
Fig. 10. Model for the maturation of PsbY. 1. After insertion, PsbY
forms a double loop intermediate with two signal peptides (SP1, SP2)
and two regions (A1 and A2) destined to become single-span mature
proteins. 2. TPP cleaves SP2 which is rapidly degraded; SP2 continues
to be held in a transmembrane form due to interactions with A2. TPP
then cleaves after SP2 yielding the mature A2 protein. 3. SP2 is now
more flexible and the A1–SP2 junction on the stromal surface can be
accessed by an unknown protease (hence the question mark) com-
pleting the maturation process. In the case of the PsbY-A2/VV mutant,
SP2 is now more hydrophobic and able to maintain a transmembrane
conformation, preventing cleavage on the stromal side.
Ó FEBS 2002 Signal peptides of thylakoid membrane proteins (Eur. J. Biochem. 269) 3139

specific and unusual properties that are especially important
for correct proteolytic cleavage following insertion. In the
cases of PsbX and PsbY-A1, the hydrophobicity of the
C-domain is critical for correct maturation and negative
charges in particular appear to be favored. In the case of
PsbY-A2, the negative charge in the translocated loop plays
a key role in defining the hydrophobicity of the A2 signal
peptide, which is of necessity low in order to facilitate the
movements that allow the final cleavage on the stromal
surface. In general, these signal peptides are not merely
additional hydrophobic regions but are rather exquisitely
structured extensions whose properties complement those of
the N-terminal regions of the mature proteins.
ACKNOWLEDGEMENTS
This work was supported by Biotechnology and Biological Sciences
Research Council grant C09633 to C. R.
REFERENCES
1. Dalbey, R.E. & Robinson, C. (1999) Protein translocation into
and across the bacterial plasma membrane and the plant thylakoid
membrane. Trends Biochem. Sci. 24, 17–22.
2. Robinson, C., Thompson, S.J. & Woolhead, C. (2001) Multiple
pathways used for the targeting of thylakoid proteins in chlor-
oplasts. Traffic 2, 245–251.
3. Lamppa, G.K. (1988) The chlorophyll a/b-binding protein inserts
into the thylakoids independent of its cognate transit peptide.
J. Biol. Chem. 263, 14996–14999.
4. Viitanen, P.V., Doran, E.R. & Dunsmuir, P. (1988) What is the
role of the transit peptide in thylakoid integration of the light-
harvesting chlorophyll a/b protein? J. Biol. Chem. 263, 15000–
15007.

13. Izard, J.W. & Kendall, D.A. (1994). Signal peptides: exquisitely
designed transport promoters. Mol. Microbiol. 13, 765–773.
14. Martoglio, B. & Dobberstein, B. (1998) Signal sequences: more
than just greasy peptides. Trends Cell Biol. 10, 410–415.
15. Michl, D., Robinson, C., Shackleton, J.B., Herrmann, R.G. &
Klo
¨
sgen, R.B. (1994) Targeting of proteins to the thylakoids by
bipartite presequences: CF
o
II is imported by a novel, third path-
way. EMBO J. 13, 1310–1317.
16. Kim, S.J., Robinson, C. & Mant, A. (1998) Sec/SRP-independent
insertion of two thylakoid membrane proteins bearing cleavable
signal peptides. FEBS Letts. 424, 105–108.
17. Lorkovic, Z.J., Schro
¨
der, W.P., Pakrasi, H.B., Irrgang, K D.,
Herrmann, R.G. & Oelmu
¨
ller, R. (1995) Molecular characterisa-
tion of PSII-W, the only nuclear-encoded component of the
photosystem II reaction centre. Proc. Natl Acad. Sci. USA 92,
8930–8934.
18. Robinson, D., Karnauchov, I., Herrmann, R.G., Klo
¨
sgen,R.B.&
Robinson, C. (1996) Protease-sensitive thylakoidal import
machinery for the Sec-, DpH- and signal recognition particle-
dependent protein targeting pathways, but not for CF

6
f subunits. J. Biol. Chem. 269, 7597–7602.
25. Kirwin, P.M., Elderfield, P.D., Williams, R.S. & Robinson, C.
(1988) Transport of proteins into chloroplasts. Organisation,
orientation and lateral distribution of the plastocyanin processing
peptidase in the thylakoid network. J. Biol. Chem. 263, 18128–
18132.
26. Kyte, J. & Doolittle, R.F. (1982) A simple method for displaying
the hydropathic character of a protein. J. Mol. Biol. 157, 105–132.
27. Engelman, D.M., Steitz, T.A. & Goldman, A. (1986) Identifying
nonpolar transbilayer helices in amino acid sequences of
membrane proteins. Annu. Rev. Biophys. Biophys. Chem. 15,
321–353.
28. Shackleton, J.B. & Robinson, C. (1991) Transport of proteins into
chloroplasts. The thylakoidal processing peptidase is a signal-type
peptidase with stringent substrate requirements at the -3 and -1
positions. J. Biol. Chem. 266, 12152–12156.
29. Dalbey, R.E. & von Heijne, G. (1992) Signal peptidases in pro-
karyotes and eukaryotes – a new protease family. Trends Biochem.
Sci. 17, 474–478.
30.Gau,A.E.,Thole,H.H.,Sokolenko,A.,Altschmied,L.,
Hermann, R.G. & Pistorius, E.K. (1998) PsbY, a novel manga-
nese-binding, low-molecular-mass protein associated with photo-
system II. Mol. Gen. Genet. 260, 56–68.
31. Thompson, S.J., Robinson, C. & Mant, A. (1999) Dual signal
peptides mediate the Sec/SRP-independent insertion of a thyla-
koid membrane polyprotein, PsbY. J. Biol. Chem. 274, 4059–4066.
32. Sasaki, K., Matsuyama, S. & Mizushima, S. (1990) In vitro kinetic
analysis of the role of the positive charge at the amino-terminal
region of signal peptides in translocation of secretory protein


Nhờ tải bản gốc
Music ♫

Copyright: Tài liệu đại học © DMCA.com Protection Status