Altered expression of tumor protein D52 regulates
apoptosis and migration of prostate cancer cells
Ramesh Ummanni
1
, Steffen Teller
1
, Heike Junker
1
, Uwe Zimmermann
2
, Simone Venz
1
, Christian
Scharf
3
,Ju
¨
rgen Giebel
4
and Reinhard Walther
1
1 Department of Medical Biochemistry and Molecular Biology, University of Greifswald, Germany
2 Department of Urology, University of Greifswald, Germany
3 Department of Otorhinolaryngology, Head and Neck Surgery, University of Greifswald, Germany
4 Department of Anatomy and Cell Biology, University of Greifswald, Germany
Prostate carcinoma (PCA) is the most common cancer
among men. In 2002, an estimated 48 650 German
men were diagnosed with this disease and 11 839 died
from PCA (). Autopsy studies have
revealed that approximately 30% of men over the age
of 50 years have microscopic evidence of prostate

loss of mitochondrial membrane potential, cell death occurs due to apopto-
sis. The disruption of the mitochondrial membrane potential indicates that
TPD52 acts upstream of the mitochondrial apoptotic reaction. To study
the effect of TPD52 expression on cell proliferation, LNCaP cells were
either transfected with enhanced green fluorescence protein-TPD52 or a
specific small hairpin RNA. Enhanced green fluorescence protein-TPD52
overexpressing cells showed an increased proliferation rate, whereas
TPD52-depleted cells showed the reverse effect. Additionally, we demon-
strate that exogenous expression of TPD52 promotes cell migration via
avb3 integrin in prostate cancer cells through activation of the protein
kinase B ⁄ Akt signaling pathway. From these results, we conclude that
TPD52 plays an important role in various molecular events, particularly in
the morphological diversification and dissemination of prostate carcinoma
cells, and may be a promising target with respect to developing new thera-
peutic strategies to treat prostate cancer.
Abbreviations
2DE, 2D gel electrophoresis; DHT, dihydroxytestosterone; DIOC
6
, dihexyloxacarbocyanine iodide; EGFP, enhanced green fluorescence
protein; MTT, 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyl-tetrazolium bromide; PCA, prostate carcinoma; PI, propidium iodide; PKB ⁄ Akt, protein
kinase B; shRNA, small hairpin RNA; TPD52, tumor protein D52.
FEBS Journal 275 (2008) 5703–5713 ª 2008 The Authors Journal compilation ª 2008 FEBS 5703
to prostate cancer [2,3]. cDNA library analysis has
revealed the differential expression of a gene that was
further assigned as TPD52 and its locus has been
mapped on chromosome 8q21 [4,5]. Its encoding gene
is also referred to as PrLZ and is a member of the
tumor protein D52 (TPD52) gene ⁄ protein family and
is designated a proto-oncogene [6]. TPD52 is over-
expressed in breast cancer [7,8] prostate cancer [9,10]

cancer cell line LNCaP. The effect of TPD52 expres-
sion on different cellular events was examined to deter-
mine the role of TPD52 expression in prostate cancer.
Results
A protein profiling study on prostate biopsies identi-
fied differentially expressed proteins in cancer contain-
ing several proteins that are known to be dysregulated
in prostate cancer [22]. Among them, we identified
TPD52 as being overexpressed in PCA compared to
benign prostate epithelium (Fig. 1A). To determine
whether TPD52 is also overexpressed at the transcrip-
tional level, TPD52 mRNA was estimated by quantita-
tive real-time PCR from RNA isolated from the same
biopsies used for proteomic analysis. RPLP0 was used
as a house keeping gene to normalize expression levels
(Fig. 1B). Real-time PCR data have shown a signifi-
cant increase (Fig. 1C, box plots) of the amount of
TPD52 mRNA in PCA compared to benign prostatic
hyperplasia, suggesting that upregulated protein
expression in PCA is caused by an enhanced transcrip-
tion rate.
To assess the physiological effects of TPD52 expres-
sion on prostate cancer progression, enhanced green
fluorescence protein (EGFP)-TPD52 fusion protein
producing constructs were generated and expression of
the fusion protein in LNCaP cells was estimated by
fluorescence microscopy (Fig. 2A) and western blotting
TPD52
TPD52
BPH PCA

with 95% confidence intervals (nonparametric two-tailed Mann–
Whitney test performed at 95% confidence interval, P < 0.0229).
Tumor protein D52 in prostate cancer R. Ummanni et al.
5704 FEBS Journal 275 (2008) 5703–5713 ª 2008 The Authors Journal compilation ª 2008 FEBS
(Fig. 2B) using anti-EFGP serum. On the other hand,
co-transfection (1 : 10 ratio) of pSUPER.neo-gfp
vector expressing small hairpin RNA (shRNA)
designed to downregulate TPD52 and recombinant
psiCHECKÔ-2-TPD52 vector followed by luciferase
assays confirmed the specificity of shRNA against the
TPD52 transcript (data not shown). Transfection of
pSUPER.neo-gfp vector expressing shRNA in EGFP-
TPD52 positive cells confirmed the downregulation of
TPD52 by up to 40% at the transcriptional level after
24 h (Fig. 2C,D). A significant downregulation was
observed at the protein level, as confirmed by western
blotting (Fig. 2E) with anti-EGFP serum and densito-
metric quantification. Corresponding bands revealed a
reduced expression of EGFP-TPD52 down to 40% of
the control level (Fig. 2F). No significant difference
was observed between nontransfected and mock trans-
fected cells.
Dysregulation of TPD52 affects the proliferation
rate of LNCaP cells
First, we studied whether overexpression or downregu-
lation of TPD52 influences the proliferation rate of
LNCaP cells. To determine the effect of TPD52
expression on cell proliferation, 3-(4,5-dimethylthiazol-
2-yl)-2,5-diphenyl-tetrazolium bromide (MTT) assays
were performed after overexpression or downregula-

Lane 3
0
50
100
150
Rel. expression of
EGFP-TPD52
M
EGFP TPD52
EGFP
24 h 48 h 72 h 96 h 120 h
Mock C
TPD52
RPLP0
EGFP-TPD52
GAPDH
pEGFP-TPD52 +
+
+
+
+
–
–
–
–
pSuper
pSuper-shRNA
12
3
ABC

After shRNA mediated knockdown of TPD52 in
LNCaP cells, caspase-9 is activated by 1.6-fold com-
pared to control cells (P £ 0.0213). Additionally, we
examined the effect of TPD52 depletion on mitochon-
drial membrane depolarization by determining mito-
chondrial transmembrane potential (Dw
m
) 48 h after
TPD52 downregulation in LNCaP cells (Fig. 4G). In
30% of the TPD52 knockdown cells, a significant
decrease of Dw
m
(P £ 0.0013) could be observed,
whereas nontransfected or mock transfected cells were
less than 10% of the total cells, suggesting that the
depolarization of the mitochondrial membrane leads to
cytochrome c release, which in turn activates caspase-9
to initiate apoptosis. The activation of caspases-3 and
-9 taken together with the loss of mitochondrial
membrane potential suggests that downregulation of
TPD52 leads to activation of the intrinsic pathway to
initiate apoptosis in LNCaP cells.
Influence of TPD52 overexpression on LNCaP cell
migration
Furthermore, we analyzed whether overexpression of
EGFP-TPD52 fusion protein affects LNCaP cell
migration. Haptotactic cell migration assays with
vitronectin and collagen type I demonstrated that
overexpression of EGFP-TPD52 stimulates specifically
avb3-mediated LNCaP cell migration on vitronectin

–+–+
+
+
––
pEGFP
pEGFP-TPD52
DHT
0.0
0.1
0.2
0.3
0.4
0.5
**
*
*
MTT formazan formation
(570 nm)
+
–+–
–+–+
+
+
––
Mock
shRNA(204)
DHT
A
B
Fig. 3. Influence of TPD52 overexpression on the proliferation of

***
0
1
2
3
4
5
Relative caspase-3 activity
Mock
+
–
–
+
–
+
–
+
–
–
–
–
–
–
+Taxol
shRNA(204)
0
1
2
3
Relative caspase-9 activity

2
10
3
10
4
1280
Events
PI
M1
10
0
10
1
10
2
10
3
10
4
26% cells
128
0
Events
PI
M1
10
0
10
1
10

of DIOC
6
; columns indicate the mean ± SD of three independent experiments performed in triplicate.
Akt
pAkt
EGFP + – + –
–+–+EGFP-TPD52
2 h
4 h
Vitronectin
**
0
250
500
750
1000
1250
EGFP
TPD52
% Age of control
0
250
500
750
1000
% Age of control
Vitronectin
**
TPD52
EGFP

physiological consequences of TPD52 expression in the
androgen responsive prostate cancer cell line LNCaP.
It is an oncogene overexpressed in prostate, breast and
ovarian cancer, as demonstrated by DNA microarray
analysis and high density tissue microarrays. Its over-
expression due to gene amplification was confirmed by
array comparative genomic hybridization, single nucle-
otide polymorphism arrays and fluoresecemce in situ
hybridization analysis to measure gene copy number
on clinically localized prostate cancer specimens
[4,9,10,23]. Expression of recombinant TPD52 in acini
of rat pancreas stimulates amylase secretion [24]. As
reported previously, the results from our proteomic
analysis aiming to define the protein signature of pros-
tate cancer biopsies revealed the overexpression of
TPD52 in cancer patient material [22]. To date, the
main physiological role of TPD52 in prostate cancer
progression remains under investigation. In a recent
study, Wang et al. [20] found that TPD52 expression
increases with age and undergoes translocation during
development from early to adult tissues.
The expression of TPD52 proteins is linked with cell
proliferation in different cancer cell types. This is high-
lighted by reports that the expression of TPD52 in
neuroepithelial cells by retroviral transduction indi-
cated its role in cell proliferation [5,25]. The presence
of androgen response elements in the promoter region
of TPD52 gene indicates that the expression of TPD52
is controlled by androgens [14]. Testosterone as the
major circulating androgen can trigger an androgen

[31]. The expression of several genes, such as CARD10
[32] and Vav3 [33], and integrins is important in deter-
mining the formation of metastatic cells [34,35]. The
expression of murine TPD52 in NIH3T3 cells induces
the expression of several genes involved in the promo-
tion of metastasis and the genes responsible for pre-
vention of metastasis were downregulated [19]. From
our cell migration assays, we found that overexpres-
sion of TPD52 in LNCaP cells promotes cell migration
towards vitronectin. Integrins are transmembrane
receptors composed of a and b subunits. To date, 24
different integrins with different combinations of 8 a
and 18 b subunits are known [36]. Integrins bind to
different extracellular matrix proteins and control
functions such as adhesion, migration, differentiation,
proliferation, survival and motility [37]. Usually, inte-
grins avb3 and avb5 are involved in cell migration and
attachment to the extracellular matrix proteins: vitro-
nectin, fibronectin, fibrinogen, laminin, osteopontin,
amongst others [38]. Vitronectin can bind to avb5 and
avb3 integrin receptors. The expression of avb3in
LNCaP is controversial. Zheng et al. [39] noted that
LNCaP cells did not express avb3. Witkowski et al.
[40] and Chatterjee et al. [41] reported the expression
of both avb3 integrins in LNCaP cells. In addition to
these reports, Putz et al. [42] reported four prostate
cancer cell lines that were derived from bone marrow
expressing av and b3 integrin subunits. The MCF-7
cells chosen lack avb3-integrin expression, making it
possible to demonstrate that overexpression of TPD52

tasis of prostate cancer patients.
In conclusion, it appears that TPD52 is involved in
different molecular processes, such as the regulation of
apoptosis and proliferation. Its association with cell
migration suggests a role in tumor dissemination.
Because the PKB ⁄ Akt pathway is the central pathway
involved in prostate cancer progression, activation of
PKB ⁄ Akt by its phosphorylation is a possible mech-
nism of cell survival and migration that is controlled
by TPD52. Taken together, TPD52 may be a potential
and valid target to improve therapeutic strategies for
better treatment.
Experimental procedures
Clinical samples collection
Tissue samples and patient data were obtained after
informed consent. The study was approved by the local eth-
ics committee of the University of Greifswald and carried
out in accordance with the declaration of Helsinki. Ultra-
sound guided biopsies were taken from each patient and
biopsies were investigated histopathologically by two expe-
rienced pathologists.
Preparation of protein/RNA extracts
Approximately 6–10 mg of prostate biopsies was homoge-
nized in 0.5 mL of Trizol
Ò
reagent (Invitrogen, Karlsruhe,
Germany) in a bead mill (Sartorius, Go
¨
ttingen, Germany).
Total protein and total RNA was isolated according to the

stain (Roth Chemicals). SYPRO
Ò
Ruby stained gel images
were scanned at 100 lm resolution using a FS-700 molecu-
lar dynamics laser densitometer (Bio-Rad) and pdquest
software, version 7.3.3 Basic (Bio-Rad). Image analysis was
carried out with the pdquest 2D analysis software package,
version 7.4 (Bio-Rad) and changes in expression level were
restricted to being greater than 1.5-fold. Protein identifica-
tion was performed as described previously [22,48].
Measurements of TPD52 gene transcripts by
quantitative real-time PCR
Quantitative real-time PCR for TPD52 expression was per-
formed using the SYBR Green kit (Eppendorf, Hamburg,
Germany) as described previously [22]. Briefly, RNA was
isolated from the same biopsies used for proteome analysis
using Trizol
Ò
reagent (Invitrogen) according to the manu-
facturers’ protocol and RNA quality was assessed by 1.0%
agarose formaldehyde gel electrophoresis. cDNA was pre-
pared by reverse transcription of 1 lg of total RNA using
oligo dT primer (15mer) and M-MLV reverse transcriptase
(Promega Corp., Madison, WI, USA). Primer pairs were
designed using the oligo direct programme (Invitrogen) and
synthesized by Invitrogen. The sequences for TPD52 and
RPLP0 (house keeping gene) are: TPD52 sense: 5¢-GAGG
AAGGAGAAGATGTTGC-3¢, TPD52 antisense: 5¢-GCC
GAATTCAAGACTTCTCC-3¢, RPLP0 sense: 5¢-TTGTGT
TCACCAAGGAGGAC-3¢, RPLP0 antisense: 5¢-GACTC

An EGFP-TPD52 fusion protein expressing recombinant
vector was generated by cloning the coding region of the
human TPD52 (Accession number NM 001001875) cDNA
derived from LNCaP cells into the vector pEGFP-N3 (Clon-
tech, Palo Alto, CA, USA). The cDNA was prepared by
reverse transcription of 1 lg of total RNA from LNCaP
cells using oligo dT primer (15mer) and M-MLV reverse
transcriptase (Promega Corp.). A specific primer pair was
designed using oligo direct programme (Invitrogen) and syn-
thesized by Invitrogen. TPD52 cDNA was generated by PCR
using Pwo DNA Polymerase (Peqlab, Erlangen, Germany).
The sense primer (5¢-GCTA
CTCGAGCCATGGACCG
CGGCGAGCAAGGT-3¢) contains a recognition site
(underlined) for the restriction enzyme XhoI. The antisense
primer (5¢-CACTT
GGTACCCAGGCTCTCCTGTGTCTT
TTC-3¢) contains a site for KpnI (underlined). Insertion of
the XhoI ⁄ KpnI digested PCR product into the XhoI ⁄ KpnI
restriction sites of the vector resulted in a C-terminal fusion
of TPD52 to EGFP. The sequence of the cloned PCR
fragment was confirmed by DNA sequencing (Seqlab,
Go
¨
ttingen, Germany).
Downregulation of TPD52
To downregulate TPD52 in LNCaP cells, we designed dif-
ferent shRNA pairs directed against three splice variants of
TPD52 using oligoengine programme and synthesized by
Invitrogen. shRNA oligos were annealed in annealing

was added, formazan production was measured at 570 nm
in a spectrophotometer (Novaspec II, Pharmacia, Uppsala,
Sweden). Cell proliferation assays were performed with and
without DHT (Sigma-Aldrich, Munich, Germany). Cell
proliferation values are the mean of three independent
experiments, each carried out with triplicate samples. For
calculation of significance, a t-test was performed using
graph pad prism, version 3.0 (GraphPad Software Inc.,
San Diego, CA, USA).
Cell migration assay
To study the influence of TPD52 on cell migration, a hapo-
totactic cell migration test was performed after overexpres-
sion of EGFP-TPD52 in LNCaP or MCF-7 cells.
Haptotactic cell migration assays were performed in Tran-
swell chambers (#3422; Costar Inc., Cambridge, MA, USA)
according to Zhang et al. [45]. Porous membranes were
coated on the bottom surface with vitronectin (10 lgÆmL
)1
)
or collagen type I (10 lgÆmL
)1
) for 1 h at 37 ° C. LNCaP
or MCF-7 cells were transfected with EGFP or EGFP-
TPD52 expressing vectors using LipofectamineÔ 2000
(Invitrogen) and grown at 37 °C ⁄ 5% CO
2
for 24 h. Trans-
fected cells were then trypsinized and washed in the pres-
ence of soyabean trypsin inhibitor with migration buffer
(RPMI 1640, 2 mm CaCl

taining glucose, RNase and PI (50 lgÆmL
)1
), and incubated
for 20 min in the dark at room temperature. After washing
with NaCl ⁄ P
i
buffer, PI uptake was analysed by fluorescence
activated cell sorting (FACS CaliburÔ System; BD Bio-
science, Erembodegem, Belgium) on an FL-2 fluorescence
detector (20 000 events were recorded for each condition).
Flow cytometry data were analysed using winmdi software
(The Scripps Research Institute, La Jolla, CA, USA).
Determination of caspase-3 and -9 activity
Caspase-3 and -9 activities were measured 48 h after down-
regulation of TPD52 using fluorogenic substrates
Ac-DEVD-AFC and LEHD-AFC, respectively. Harvested
cells were lysed with caspase lysis buffer (10 mm Tris–HCl,
10 mm sodium phosphate buffer, pH 7.5, 130 mm NaCl,
1% Triton X-100 and 10 mm Na
2
P
2
O
7
) and then incubated
with the respective substrate (25 lgÆmL
)1
)in20mm Hepes
(pH 7.5), 10% glycerol and 2 mm dithiothreitol at 37 °C
for 2 h. The release of AFC was analyzed by fluorimeter

Blocking was carried out in 1· Rotiblock solution (Roth
Chemicals) followed by incubating the membrane with pri-
mary antibody [mouse anti-(human EGFP); 1 : 2000
(Roche Chemicals); rabbit anti-(human GAPDH) (Roche
Chemicals) 1 : 2000 or rabbit anti-(human AKT) or Ser473
phospho AKT 1 : 1000 (Cell Signalling Technology, Frank-
furt, Germany)] overnight at 4 °C. Excess antibodies were
removed by washing with NaCl–Tris–Tween 20. Incubation
with secondary antibody conjugated to horseradish per-
oxidase [anti-(mouse IgG) or anti-(rabbit IgG), diluted
1 : 5000 in 1· Rotiblock] was performed for 1 h at room
temperature. After three washes, the reaction was developed
by the addition of LumiGLO substrate (Cell Signalling
Technology). The emitted light was captured on X-ray film.
Acknowledgements
Ramesh Ummanni was supported by the Alfried-
Krupp von Bohlen und Halbach Stiftung, Graduierten-
kolleg Tumorbiologie. We thank Chithra devi Palani
for technical support concerning the caspase activity
measurements.
References
1 Scardino PT (1989) Early detection of prostate cancer.
Urol Clin North Am 16, 635–655.
2 Macoska JA, Trybus TM, Sakr WA, Wolf MC, Benson
PD, Powell IJ & Pontes JE (1994) Fluorescence in situ
hybridization analysis of 8p allelic loss and chromosome
8 instability in human prostate cancer. Cancer Res 54,
3824–3830.
3 Macoska JA, Trybus TM, Benson PD, Sakr WA,
Grignon DJ, Wojno KD, Pietruk T & Powell IJ (1995)

12968.
9 Rubin MA, Varambally S, Beroukhim R, Tomlins SA,
Rhodes DR, Paris PL, Hofer MD, Storz-Schweizer M,
Kuefer R, Fletcher JA et al. (2004) Overexpression,
amplification, and androgen regulation of TPD52 in
prostate cancer. Cancer Res 64, 3814–3822.
10 Wang R, Xu J, Saramaki O, Visakorpi T, Sutherland
WM, Zhou J, Sen B, Lim SD, Mabjeesh N, Amin M
et al. (2004) PrLZ, a novel prostate-specific and andro-
gen-responsive gene of the TPD52 family, amplified in
chromosome 8q21.1 and overexpressed in human pros-
tate cancer. Cancer Res 64, 1589–1594.
11 Byrne JA, Balleine RL, Schoenberg FM, Mercieca J,
Chiew YE, Livnat Y, St HL, Peters GB, Byth K, Kar-
lan BY et al. (2005) Tumor protein D52 (TPD52) is
overexpressed and a gene amplification target in ovarian
cancer. Int J Cancer 117, 1049–1054.
12 Scanlan MJ & Jager D (2001) Challenges to the devel-
opment of antigen-specific breast cancer vaccines.
Breast Cancer Res 3, 95–98.
13 Chen SL, Zhang XK, Halverson DO, Byeon MK,
Schweinfest CW, Ferris DK & Bhat NK (1997) Charac-
terization of human N8 protein. Oncogene 15, 2577–
2588.
14 Nelson PS, Clegg N, Arnold H, Ferguson C, Bonham
M, White J, Hood L & Lin B (2002) The program of
androgen-responsive genes in neoplastic prostate epithe-
lium. Proc Natl Acad Sci USA 99, 11890–11895.
15 Kaspar KM, Thomas DD, Taft WB, Takeshita E,
Weng N & Groblewski GE (2003) CaM kinase II regu-

Prostate 36, 14–22.
22 Ummanni R, Junker H, Zimmermann U, Venz S, Teller
S, Giebel J, Scharf C, Woenckhaus C, Dombrowski F
& Walther R (2008) Prohibitin identified by proteomic
analysis of prostate biopsies distinguishes hyperplasia
and cancer. Cancer Lett 266, 171–185.
23 Chen SL, Maroulakou IG, Green JE, Romano-Spica V,
Modi W, Lautenberger J & Bhat NK (1996) Isolation
and characterization of a novel gene expressed in multi-
ple cancers. Oncogene 12, 741–751.
24 Thomas DD, Taft WB, Kaspar KM & Groblewski GE
(2001) CRHSP-28 regulates Ca(2+)-stimulated secre-
tion in permeabilized acinar cells. J Biol Chem 276,
28866–28872.
25 Proux V, Provot S, Felder-Schmittbuhl MP, Laugier D,
Calothy G & Marx M (1996) Characterization of a leu-
cine zipper-containing protein identified by retroviral
insertion in avian neuroretina cells. J Biol Chem 271,
30790–30797.
26 Ellis JA, Sinclair R & Harrap SB (2002) Androgenetic
alopecia: pathogenesis and potential for therapy. Expert
Rev Mol Med 4, 1–11.
27 DePrimo SE, Diehn M, Nelson JB, Reiter RE, Matese
J, Fero M, Tibshirani R, Brown PO & Brooks JD
(2002) Transcriptional programs activated by exposure
of human prostate cancer cells to androgen. Genome
Biol 3, RESEARCH0032.
28 Cho S, Ko HM, Kim JM, Lee JA, Park JE, Jang MS,
Park SG, Lee DH, Ryu SE & Park BC (2004) Positive
regulation of apoptosis signal-regulating kinase 1 by

21785–21788.
37 Giancotti FG & Ruoslahti E (1999) Integrin signaling.
Science 285, 1028–1032.
38 Varner JA & Cheresh DA (1996) Tumor angiogenesis
and the role of vascular cell integrin alphavbeta3.
Important Adv Oncol 1996, 69–87.
39 Zheng DQ, Woodard AS, Tallini G & Languino LR
(2000) Substrate specificity of alpha(v)beta(3) integrin-
mediated cell migration and phosphatidylinositol
3-kinase ⁄ AKT pathway activation. J Biol Chem 275,
24565–24574.
40 Witkowski CM, Rabinovitz I, Nagle RB, Affinito KS &
Cress AE (1993) Characterization of integrin subunits,
cellular adhesion and tumorgenicity of four human
prostate cell lines. J Cancer Res Clin Oncol 119, 637–
644.
41 Chatterjee S, Brite KH & Matsumura A (2001) Induc-
tion of apoptosis of integrin-expressing human prostate
cancer cells by cyclic Arg-Gly-Asp peptides. Clin Cancer
Res 7, 3006–3011.
42 Putz E, Witter K, Offner S, Stosiek P, Zippelius A,
Johnson J, Zahn R, Riethmuller G & Pantel K (1999)
Phenotypic characteristics of cell lines derived from dis-
seminated cancer cells in bone marrow of patients with
solid epithelial tumors: establishment of working models
for human micrometastases. Cancer Res 59, 241–248.
43 Brooks PC, Klemke RL, Schon S, Lewis JM, Schwartz
MA & Cheresh DA (1997) Insulin-like growth factor
receptor cooperates with integrin alpha v beta 5 to pro-
mote tumor cell dissemination in vivo. J Clin Invest 99,

drion-specific fluorochromes. Immunol Lett 61, 157–163.
R. Ummanni et al. Tumor protein D52 in prostate cancer
FEBS Journal 275 (2008) 5703–5713 ª 2008 The Authors Journal compilation ª 2008 FEBS 5713