Identification of the epitope of a monoclonal antibody
that disrupts binding of human transferrin to the human
transferrin receptor
Evelyn M. Teh
1
, Jeff Hewitt
1
, Karen C. Ung
1
, Tanya A. M. Griffiths
1
, Vinh Nguyen
1
, Sara K. Briggs
2
,
Anne B. Mason
2
and Ross T. A. MacGillivray
1
1 Department of Biochemistry and Molecular Biology and Centre for Blood Research, University of British Columbia, Vancouver, Canada
2 Department of Biochemistry, University of Vermont, College of Medicine, Burlington, Vermont, USA
The transferrins (TF) are a group of metal-binding pro-
teins that are involved in iron homeostasis [1]. Struc-
tural studies have revealed that the TFs consist of a
single polypeptide chain of M
r
 80000 that folds into
two halves called the N- and C-lobes, each of approxi-
mately 330 amino acids. In human transferrin (hTF),
the lobes are connected by a short peptide of seven resi-

transferrin C-lobe; transferrin–transferrin
receptor interaction; epitope mapping;
monoclonal antibody
Correspondence
R.T.A. MacGillivray, Department of
Biochemistry and Molecular Biology and
Centre for Blood Research, University of
British Columbia, Vancouver, BC, V6T 1Z3,
Canada
Tel: +1 604 822 3027
Fax: +1 604 822 4364
E-mail: [email protected]
(Received 9 July 2005, revised 7 October
2005, accepted 19 October 2005)
doi:10.1111/j.1742-4658.2005.05028.x
The molecular basis of the transferrin (TF)–transferrin receptor (TFR)
interaction is not known. The C-lobe of TF is required to facilitate binding
to the TFR and both the N- and C-lobes are necessary for maximal bind-
ing. Several mAb have been raised against human transferrin (hTF). One
of these, designated F11, is specific to the C-lobe of hTF and does not
recognize mouse or pig TF. Furthermore, mAb F11 inhibits the binding of
TF to TFR on HeLa cells. To map the epitope for mAb F11, constructs
spanning various regions of hTF were expressed as glutathione S-trans-
ferase (GST) fusion proteins in Escherichia coli. The recombinant fusion
proteins were analysed in an iterative fashion by immunoblotting using
mAb F11 as the probe. This process resulted in the localization of the F11
epitope to the C1 domain (residues 365–401) of hTF. Subsequent computer
modelling suggested that the epitope is probably restricted to a surface
patch of hTF consisting of residues 365–385. Mutagenesis of the F11
epitope of hTF to the sequence of either mouse or pig TF confirmed the

literature regarding the exact region(s) of TF involved
in TFR binding, it is generally accepted that both lobes
of TF are required for maximal binding [15–17]. A par-
ticularly intriguing aspect of the interaction of TF with
the TFR is its pH dependence. At pH 7.4, diferric TF
preferentially binds to TFR. At pH 5.6 (a value within
the putative pH range of endosomes), iron free or apo-
TF preferentially binds to TFR. Since a substantial and
well-documented conformational change (60° opening
and twisting [18]), accompanies the release of iron from
TF, a compensating change in the TFR conformation
might also be expected. In fact, the TFR has been
shown to play a role in iron release from TF in a pH
sensitive manner [19–21]. A structure of the hTF–hTFR
complex was recently determined with cryo-electron
microscopy [22]. In this model, the transferrin N-lobe is
situated between the membrane and the TFR ectodo-
main while the C-lobe binds to the TFR helical domain
through side chain contacts of the C1 domain. More
detailed information about the molecular interactions
between the C-lobe and the TFR was obtained by
hydroxyl radical-mediated protein footprinting and
mass spectrometry [23]. In these experiments, specific
C-lobe sequences (residues 381–401, 415–433 and
457–470) were protected against oxidation and thus
proposed to be involved in receptor binding.
Another approach to determine the regions of TF
that are critical to receptor binding is the production
of specific monoclonal antibodies (mAb) that can be
tested for their ability to block such binding. Mason

Fig. 1. mAb mediated inhibition of hTF binding to TFR on HeLa
cells.
125
I-labelled hTF was incubated with HeLa cells in the pres-
ence of increasing amounts of mAb and the resultant binding
expressed as the percentage of the binding in the absence of mAb.
The mAbs used were: aHT + N
1,
aHT + N
2,
HTF.14, F11 and E8
[24].
E. M. Teh et al. Transferrin–transferrin receptor interaction
FEBS Journal 272 (2005) 6344–6353 ª 2005 The Authors Journal compilation ª 2005 FEBS 6345
Two of the antibodies (aHT + N
1
and aHT + N
2
)
partially blocked binding whereas the third antibody
(HTF.14) blocked virtually all binding to TFR. The
antibodies to the C-lobe (F11 and E8, which share the
same or a very similar epitope [24]) inhibited virtually
all binding of hTF to TFR. Also, treatment of hTF
with biotin resulted in a preparation of biotinylated
hTF that was not recognized by the mAb F11 (data
not shown). As biotin binds to lysyl residues, this
result suggests that a lysyl residue may be involved in
antibody–epitope recognition.
Analysis of IPTG-induced fusion protein expression

Fig. 3. Western blot analysis of GST–hTF fusion proteins. (A) West-
ern blot analysis using an anti-GST serum before (–) and after (+)
induction of the fusion protein. The following expression plasmids
were used: (lanes 1–2) pGEX4T3; (lanes 3–4) hTF N-lobe; (lanes 5–6)
hTF C-lobe; (lanes 7–8) hTF-5; (lanes 9–10) hTF-6; (lanes 11–12)
hTF-7; (lanes 13–14) hTF-8. (B) Western blot analysis using the mAb
F11 after induction of the fusion protein. The following expression
plasmids were used: (lane 1) pGEX4T3; (lane 2) hTF; (lane 3) hTF
N-lobe; (lane 4) hTF C-lobe; (lane 5) hTF-5; (lane 6) hTF-6; (lane 7)
hTF-7; (Lane 8) hTF-8.
Transferrin–transferrin receptor interaction E. M. Teh et al.
6346 FEBS Journal 272 (2005) 6344–6353 ª 2005 The Authors Journal compilation ª 2005 FEBS
consistent with their predicted fusion protein composi-
tions (Fig. 3A, lanes 8, 10, 12 and 14; Fig. 4A, lanes 7,
9, 11, 13, 15 and 17).
Epitope mapping for mAb F11
Western blot analysis of the different C-lobe fragments
with the mAb F11 allowed the determination of the
specific region of the C-lobe containing the epitope
(Fig. 3B). Full-length hTF was used as a positive con-
trol and a bacterial lysate from E. coli transformed with
pGEX 4T3 was used as a negative control. In agreement
with previous studies, only full-length hTF (lane 2) and
the hTF C-lobe (lane 4) fusion protein showed reactivity
with the antibody [24]. Following division of the C-lobe
into four fragments of approximately 100 residues each,
only the hTF-5 fusion protein (lane 5) was positive. This
fragment encompasses residues 342–440 of hTF and
maps to the amino terminus of the C-lobe contained lar-
gely within the C1 domain.

including the pGEX 4T3 control. Furthermore, the
hTF C-lobe, hTF-5C and hTF-5D (lanes 4, 10 and 12)
samples had additional bands at lower molecular
weights not seen in the pGEX 4T3 control (lane 2).
The intensities of these bands corresponded to the pos-
itive reactivity of the target protein and may therefore
have been degradation products of the truncated pro-
tein. The sensitivity of the anti-GST serum to detect
lower concentrations of the target protein is not as
great as that of the mAb F11; therefore, it is not sur-
prising that the corresponding bands are not seen in
the anti-GST blots. As hTF-5E and 5F fusion proteins
are short, 23 and 17 amino acid residues, respectively,
it could be argued that the absence of positive signal
be attributed to protein degradation. However, the
GST moiety was detected with the anti-GST serum
(Fig. 4A, lanes 15 and 17) and showed the appropri-
ate, slight increase in molecular mass corresponding
to the theoretical GST C-lobe fusion product, so this
possibility seems unlikely.
Studies with synthetic peptide
To investigate the identity of the F11 epitope further,
a synthetic peptide having a short sequence
KIECVSAETTEDCI (amino acid residues 365–378 of
the C-lobe of hTF) from the positive fusion protein
hTF-5B (Fig. 4B, lane 8) was synthesized for use in a
competitive immunoassay. Unfortunately, the peptide
was insoluble in both reducing and nonreducing aque-
ous solutions and this precluded its use in further
studies. An alternative approach was used to verify the

B
Fig. 5. Western blot analysis of the modified hTF-5D GST fusion
proteins. (A) Anti-GST blot of the hTF-5D and the modified con-
structs before (–) and after (+) induction with IPTG. The following
expression plasmids were used: (lane 1–2) hTF-5D; (lane 3–4) hTF-
5D T373N; (lane 5–6) hTF-5D V369E. (B) The F11 blot of hTF-5D
and the modified hTF-5D constructs before (–) and after (+) induc-
tion of the fusion protein. The following expression plasmids were
used: (lane 1–2) hTF-5D; (lane 3–4) hTF-5D T373N; (lane 5–6)
hTF-5D V369E. The arrow denotes the position of the GST-5D
constructs.
Transferrin–transferrin receptor interaction E. M. Teh et al.
6348 FEBS Journal 272 (2005) 6344–6353 ª 2005 The Authors Journal compilation ª 2005 FEBS
which resembles the pig TF sequence, nor the hTF-5D
V369E (Fig. 5B, lane 6) representing the mouse
sequence in the putative epitope region, had a positive
immunoreaction with mAb F11 (compare to hTF-5D,
Fig. 5B, lane 2). This result is consistent with the
earlier mapping of the mAb F11 to a sequence in the
C-lobe of human TF while showing no cross-reactivity
with pig and mouse TF [24].
Discussion
The present study establishes that the epitope of the
F11 antibody is in the C-lobe of hTF, specifically
within residues 365–401 of the C1 domain. Further-
more, binding of the F11 antibody to hTF inhibits
binding to TFR (Fig. 1). The residues of TF that are
involved in receptor binding have remained elusive,
but it has been documented that the C-lobe binds to
TFR with a much higher affinity than the N-lobe and

two lobes were subsequently separated after treatment
of the full-length TF with factor Xa. In the current
study, we have also obtained expression of the C-lobe
of TF although we have not determined whether it
assumes a native conformation. It is possible that the
29-kDa GST moiety in this system provides some sta-
bilization.
Immunoscreening of the GST-hTF C-lobe fragments
by Western blot analysis was used to identify the mAb
F11 epitope, which was localized to residues 365–401
in the amino-terminal region of the hTF C-lobe. Con-
firmation for the identification of this particular region
as the mAb F11 epitope came from two observations.
First, we have shown that a single amino acid substitu-
tion in either one of two residues between positions
365 and 378 abolished the immunoreactivity to mAb
F11 (Fig. 5B). The two mutations in this region corres-
pond to the amino acid sequences of either mouse
(V369E) or pig (T373N) TF, neither of which is recog-
nized by the mAb F11. Substitution of a negatively
charged glutamyl residue for the hydrophobic valyl
residue observed in the mouse sequence abolished all
reactivity to the F11 antibody. Furthermore, the fairly
conservative T373N substitution observed in the pig
TF sequence also resulted in loss of immunoreactivity.
An M382V substitution in mouse and pig TF could
also contribute to the lack of cross reactivity between
species. Antibodies can be exquisitely sensitive to such
small changes in sequence [29]. These results provide
strong support that the epitope is located within resi-

acids that comprise part of the F11 epitope to be
involved in TFR binding. In their study, oxidative
modification of various peptides in the C-lobe of hTF
was monitored. Peptides that were oxidized while the
C-lobe was isolated but were protected from oxidative
modification after the C-lobe had associated with the
TFR were suggested to be involved in hTF–TFR
association. A region of hTF we have proposed to be
involved in TFR binding was shown to be protected
from oxidative modification and was thus proposed to
undergo a conformational change upon hTF–TFR
binding. An elegant study by Cheng et al. [22] des-
cribes the structure of hTF complexed with hTFR as
determined by cryo-electron microscopy. The authors
proposed that a positively charged patch of TFR con-
taining many basic residues interacts with a comple-
mentary negative patch of hTF containing acidic
residues. The F11 epitope described in this study con-
tains seven acidic residues, two of which were pro-
posed to interact with the TFR (Glu367 and Glu372)
[22]. It is possible that the F11 epitope is not within
the binding site of TF for the receptor but that binding
of the antibody leads to steric hindrance or conforma-
tional changes that alter the binding site. However, the
agreement of the F11 epitope with the studies of
Cheng [22] and Liu [23] argues against this idea.
It has been proposed from modelling studies that
both the C1 and N1 domains anchor hTF to the TFR
[9]. In contrast, the C2 and N2 domains are thought
to be the main source of movement about the hinge in

were from
Stratagene (La Jolla, CA). E. coli strain BL21 (DE3) was
from Novagen (San Diego, CA). The vector pGEX 4T3
used for the expression of the GST fusion proteins, the
GST Detection Module (including anti-GST serum) and
the chemiluminescence detection kit were from GE Health-
care (Piscataway, NJ). Isopropyl-b-D-thiogalactopyranoside
(IPTG) and BSA were from the Sigma Chemical Company
(Oakville, ON) as were horseradish peroxidase-conjugated
immunoglobulins. Human transferrin was from Roche
Applied Science (Laval, QC). Immunopure NHS-LC-Biotin
and Immunopure avidin-horseradish peroxidase were from
Pierce (Rockford, IL). The TMB Microwell peroxidase sub-
strate system was from Kirkegaard and Perry Laboratories
(Gaithersburg, MD). All other chemicals and reagents were
of analytical grade. Milli-Q water was used to prepare all
solutions. The F11 and E8 antibodies were a generous gift
from Dr James D. Cook and coworkers at the University
of Kansas Medical Center in Kansas City, KS.
TFR binding studies
To examine the ability of various monoclonal antibodies
to block binding of hTF to the hTFR on HeLa cells, a
limiting amount of
125
I-labelled diferric hTF (20 pmol) was
A
B
Fig. 6. Location of the mAb F11 epitope in hTF. The C1 and N1
domains are highlighted in light grey; C2 and N2 domains are col-
oured dark grey. The F11 epitope (residues 365–401), which is in

kin Elmer Cetus DNA Thermal Cycler 480 and consisted
of 30 cycles of denaturation at 94 ° C for 1 min, annealing
at 54 °C for 1 min and extension at 72 °C for 1 min fol-
lowed by a 10-min final extension at 72 °C. Using specific
flanking restriction sites listed in Table 2, the PCR products
were cloned into pBluescript SK– vector and transformed
into E. coli DH5aF¢. To confirm the expected sequences of
the constructs and to ensure the absence of mutations
introduced during the PCR steps, DNA sequence analysis
of positive clones was performed using an ABI Prism
Model 310 Genetic Analysis DNA Sequencer (Dr Ivan
Sadowski, University of British Columbia, BC).
Cloning of hTF fragments into the pGEX 4T3
vector
The hTF fragments were subcloned into the pGEX 4T3
vector for the expression of GST fusion proteins. Briefly,
the pBluescript–hTF clones were digested with either XhoI
and NotI (hTF N-lobe) or BamHI and EcoRI (hTF
C-lobe), purified and ligated into the 3¢ end of the GST
sequence in the pGEX 4T3 expression vector. The pGEX
4T3 constructs were transformed into E. coli strain BL21
(DE3) (Novagen, Madison, WI) and positive clones were
selected by PCR screening and verified by both multiple
restriction digests and DNA sequence analysis.
Additional pGEX 4T3-hTF-5 based recombinant plas-
mids were constructed that contained subfragments of hTF-
5 designated 5A to 5F. These subclones were obtained by
PCR amplification using the pGEX 4T3 hTF-5 as a tem-
plate, the hTF-5 forward primer and a new reverse primer
(Table 2). PCR conditions were 30 cycles of denaturation

hTF5A
c
AAAGAATTCTTAGGTGGTCTCTGCTGATACACACTC BamHI ⁄ EcoRI
hTF5B
c
AAAGAATTCTTAATGCAGTCTTCGGTGGTCTCT BamHI ⁄ EcoRI
hTF5C
c
AAAGAATTCTTACTTGCCCGCTATGTAGACAAA BamHI ⁄ EcoRI
hTF5D
c
AAAGAATTCTTAATCCTCACAATTATCGCTCTTATT BamHI ⁄ EcoRI
hTF5E
c
AAAGAATTCTTACCCTACACTGTTAACACT BamHI ⁄ EcoRI
hTF5F
c
AAAGAATTCTTAAACACTCCACTCATCACA BamHI ⁄ EcoRI
T373N
d
GTGTATCAGCAGAGAACACCGAAGACTGCATCGCC
GGCGATGCAGTCTTCGGTGTTCTCTGCTGATACAC
V369E
d
GGGAAAATAGAGTGTGAATCAGCAGAGACCACC
GGTGGTCTCTGCTGATTCACACTCTATTTTCCC
a
Restriction sites are underlined.
b
The forward primer used with the

binant plasmid was inoculated into Luria broth (LB) con-
taining 100 lgÆmL
)1
ampicillin and grown overnight at
37 °C. A 100-lL aliquot of the overnight culture was then
used to inoculate 1 mL of LB ⁄ ampicillin medium at 37 °C
for 3 h. To induce the expression of the GST–hTF fusion
proteins, IPTG was added to a final concentration of 1 mm
and the cultures were incubated for an additional 3 h at
37 °C. After 3 h, the bacteria were harvested by centrifuga-
tion and 200 lLof3· SDS sample buffer was added to
the cell pellets. The mixture was then boiled at 95 °C for
5 min to lyse the cells.
Gel electrophoresis and western blotting
SDS/PAGE was performed using a mini gel apparatus.
Equal volumes of the whole cell lysates were resolved on
a 12.5% acrylamide separating gel (1 : 29 bis:acrylamide)
with a 5% acrylamide stacking gel. Gels were stained with
Coomassie Blue to visualize the protein bands.
For western blot analysis, the proteins were transferred
to a poly(vinylidene difluoride) membrane (Bio-Rad) at
400 mA for 1 h. Following transfer, the membrane was
blocked overnight at 4 °C in phosphate buffered saline and
0.02% Tween 20 (NaCl ⁄ P
i
-T) with 4% BSA. The mem-
branes were washed in NaCl ⁄ P
i
-T and incubated with the
monoclonal antibody antihuman F

Transfusion Science supported by the CIHR and the
Heart and Stroke Foundation of Canada.
References
1 MacGillivray RTA & Mason AB (2002) Transferrins. In
Molecular and Cellular Iron Transport (Templeton, DM,
ed.), pp. 41–69. Marcel Dekker Inc., New York, NY.
2 Anderson BF, Baker HM, Dodson EJ, Norris GE,
Rumball SV, Waters JM & Baker EN (1987) Structure
of human lactoferrin at 3.2-A resolution. Proc Natl
Acad Sci USA 84, 1769–1773.
3 Anderson BF, Baker HM, Norris GE, Rumball SV &
Baker EN (1990) Apolactoferrin structure demonstrates
ligand-induced conformational change in transferrins.
Nature 344, 784–787.
4 Bailey S, Evans RW, Garratt RC, Gorinsky B, Hasnain
S, Horsburgh C, Jhoti H, Lindley PF, Mydin A, Sarra
R & Watson JL (1988) Molecular structure of serum
transferrin at 3.3-A resolution. Biochemistry 27, 5804–
5812.
5 Baker EN & Lindley PF (1992) New perspectives on the
structure and function of transferrins. J Inorg Biochem
47, 147–160.
6 Aisen P, Enns C & Wessling-Resnick M (2001) Chemis-
try and biology of eukaryotic iron metabolism. Int J
Biochem Cell Biol 33, 940–959.
Transferrin–transferrin receptor interaction E. M. Teh et al.
6352 FEBS Journal 272 (2005) 6344–6353 ª 2005 The Authors Journal compilation ª 2005 FEBS
7 Enns CA (2002) The transferrin receptor. In Molecular
and Cellular Iron Transport (Templeton, DM, ed.), pp.
71–94. Marcel and Dekker Inc., New York, NY.

chromatosis protein HFE. J Biol Chem 275, 38135–
38138.
15 Mason AB, Tam BM, Woodworth RC, Oliver RW,
Green BN, Lin LN, Brandts JF, Savage KJ, Lineback
JA & MacGillivray RT (1997) Receptor recognition
sites reside in both lobes of human serum transferrin.
Biochem J 326, 77–85.
16 Zak O, Trinder D & Aisen P (1994) Primary receptor-
recognition site of human transferrin is in the C-term-
inal lobe. J Biol Chem 269, 7110–7114.
17 Zak O & Aisen P (2002) A new method for obtaining
human transferrin C-lobe in the native conformation:
preparation and properties. Biochemistry 41, 1647–1653.
18 Jeffrey PD, Bewley MC, MacGillivray RT, Mason AB,
Woodworth RC & Baker EN (1998) Ligand-induced
conformational change in transferrins: crystal structure
of the open form of the N-terminal half-molecule of
human transferrin. Biochemistry 37, 13978–13986.
19 Bali PK & Aisen P (1991) Receptor-modulated iron
release from transferrin: differential effects on N- and
C-terminal sites. Biochemistry 30, 9947–9952.
20 Bali PK, Zak O & Aisen P (1991) A new role for the
transferrin receptor in the release of iron from transfer-
rin. Biochemistry 30, 324–328.
21 Sipe DM & Murphy RF (1991) Binding to cellular
receptors results in increased iron release from transfer-
rin at mildly acidic pH. J Biol Chem 266 , 8002–8007.
22 Cheng Y, Zak O, Aisen P, Harrison SC & Walz T
(2004) Structure of the human transferrin receptor-
transferrin complex. Cell 116, 565–576.

Structure of an antibody-protein antigen complex.
J Biol Chem 268, 10705–10708.
30 Zuccola HJ (1993) PhD Thesis, Georgia Institute of
Technology, Atlanta.
31 Hall DR, Hadden JM, Leonard GA, Bailey S, Neu M,
Winn M & Lindley PF (2002) The crystal and molecular
structures of diferric porcine and rabbit serum transfer-
rins at resolutions of 2.15 and 2.60 A, respectively. Acta
Crystallogr D Biol Crystallogr 58, 70–80.
E. M. Teh et al. Transferrin–transferrin receptor interaction
FEBS Journal 272 (2005) 6344–6353 ª 2005 The Authors Journal compilation ª 2005 FEBS 6353