
vector khác nhau

 
huyên ngành; 

 Abstract:  





Keywords: ; ; Cecropin; Kháng kháng sinh; Sinh y Content
Nhân ngày i 7/4/2011, t
: không hà  m

sinh   p giúp nhân
 sinh.

 kháng s
  
 Tro

 
 
 .  
n không
 
 .
v 

 
 . 












 . 













 . cecropin 


cecropin 
cecropin E. coli 
Tách dòng và biểu hiện cecropin trong các hệ
vector khác nhau”. cecropin B 



cecropin B cecropin 

E. coli.


Tách dòng và biểu hiện cecropin tái tổ hợp trong các hệ vector khác nhau

 nh giá ng








aaaaccgcgatcgctggtccagccttgac
pJET1.2 F
cgactcactatagggagagcggc
    gen cecropin 
pJET1.2-cecropin
pJET1.2 R
aagaacatcgattttccatggcag
T7
aatacgactcactatag
Nhân    gen cecropin
pBS-cecropin,
pCR2.1-cecropin
M13/pUC
reverse
caggaaacagctatgac
pGEX-
Bam-cec
actggatccatgaatttctcaaggatatttttcgtgtt
cgctttggttctggct
Nhân    cecropin 
-4T-1
pGEX F
gggctggcaagccacgtttggtg
Nhân    gen cecropin
trong vector tái   -
cecropin
pGEX R
cctctgacacatgcagctcccgg
pET28a-
Eco-cec

-         Taq DNA polymerase (Fermentas),
AmpliTaq Gold® DNA polymerase (Applied Biosystems)
-     Fermentas, New England Biolabs), enzyme T4 DNA ligase
(Fermentas, Invitrogen)
- Protease: thrombin (GE Healthcare), enterokinase (New England Biolabs)
- % trypton, 0.5% ca
men, 0.5% NaCl
- Kit  QIAquick PCR Purification Kit (QIAGEN)
-                 
phosphate pH 7.4 (3.1 g NaH
2
PO
4
.H
2
O, 10.9 g Na
2
HPO
4,
thêm H
2
PBS (150 mM
NaCl, 20 mM sodium phosphate), PBS lysis (150 mM NaCl, 20 mM sodium phosphate, 1 mM
PMSF, 1% Triton-X100), GST elution (50 mM Tris-HCl pH 8, 20 mM glutathione reduced), His
lysis (50 mM NaH
2
PO
4
, 300 mM NaCl, 10 mM imidazole, 1 mM PMSF, 1% Triton-X100), His
wash (50 mM NaH


Hình 10. .

CHƢƠNG 3 - KẾT QUẢ
 
1. -4T-1
(pGEX-cecH, pGEX-cecN, pGEX-cecT-cecH, pET 28a-
cecN, pET 28a-cecT-cecH, pET 32b-cecN, pET 32b-
cecT).
2. Biu hin thành công:
a. i dng dung hp vi GST trong c 2 chng t bào
biu hin E. coli BL21 (DE3) và E. coli JM109.
b. i dng dung hp vi 2 Tag His+GST trong chng t bào
biu hin E. coli BL21 (DE3).
c. i dng dung hp vi Trx trong chng t bào biu
hin E. coli BL21 (DE3).
3. c trng thái biu hin ca các cecropin dung hp:
a. GST-cecH, GST-cecN, GST-cecT; His+GST-cecH, His+GST-cecN  dng
th vùi.
b. Trx-cecH, Trx-cecN, Trx-cecT  dng tan.
4. Làm tan thành công các cecropin dung hp vi GST dng th vùi bng SDS 0.5% và
ure 8 M.
5. Tinh sch thành công các cecropin dung hp vi Trx (Trx-cecH, Trx-cecN, Trx-cecT)
và cecropin dung hp vi GST (GST-cecH, GST-cecN, GST-cecT) sau khi làm tan
bng ure 8 M. Hiu sut tinh sch cecropin dung hp vi Tag Trx cao hn hn so vi
Tag GST.
6. u x c cecropin dung hp bng protease thrombin (cecropin dung hp
vi GST).



Analytical Biochemistry, 316, pp. 223-231.
7.Nature Biotechnology, 17, pp. 1165-1169.
8.Brogden K.         Pasteurella
haemolytica, Escherichia coli, and Klebsiella pneumoniae Infection and
Immunity, 60, pp. 5182-5189.
9.Brogden K.     pore formers or metabolic inhibitors in
Nature, 3, pp. 238-250.
10. Brogden K. A., Ackermann M., McCray P. B., Jr., Tack B. F.  Antimicrobial
peptides in animals and their role in host defencesInternational Journal of Antimicrobial
Agents, 22, pp. 465-478.
11.       
Current Opinion in Immunology, 18, pp. 24-30.
12. Bulet P., Charlet M., Hetru C. (2003), Innate Immunity, Humana Press, Totowa, pp. 89-107.
13. Bulet P., Stöcklin R. antimicrobial peptides: Structures, properties and gene
rProtein and Peptide Letters, 12, pp. 3-11.
14. Bulet P., Stöcklin R., Menin L. (2004), Anti-microbial peptides: from invertebrates to
vertebratesImmunological Reviews, 198, pp. 169-184.
15. Callaway J. E., Lai J., Haselbeck B., Baltaian M., Bonnesen S. P., Weickmann J., Wilcox G.,
 is essential for broad-spectrum
Antimicrobial agents and Chemotherapy, 37(8), pp. 1614-1619.
16. Expression
of a cytotoxic cationic antibacterial peptide in Escherichia coli using two fusion partners
Protein Expression and Purification, 57, pp. 303-311.
17. 
The AAPS Journal, 8(3), pp. E572-E579.
18. Fei D., Wei X., Xueyin D., Xianxiu X. (1999), 
, Science in China, 42(5), pp. 494-500.
19. Science, 286, pp. 420-421.
20. Ganz T.    of antimicrob    , Integrative and
Comparative Biology, 43, pp. 300-304.

cation, and characterization of the shrimp antimicrobial
peptide, Ch-penaeidin, in Pichia pastorisProtein Expression and Purification, 39, pp. 144-
151.
33. Li Y    roteins for fusion expression of antimicrobial
peptides in Escherichia coliBiotechnology and Applied Biochemistry, 54, pp. 1-9.
34. Liang Y., Wang J. X., Zhao X. F., Du X. J., Xue J. F. (2006), Molecular cloning and
characterization of cecropin from the ho Musca domestica), and its expression in
Escherichia coliDevelopmental and Comparative Immunology, 30, pp. 249-257.
35. Studies on the properties of Cecropin-
XJ expressed in yeast from Xinjiang silkwormWei Sheng Wu Xue Bao, 43(5), pp. 635-641.
36. Lu X. M., Jin X. B., Zhu J. Y., Mei H. F., Chu F. J., Wang Y., Expression
of the antimicrobial peptide cecropin fused with human lysozyme in Escherichia coli
Applied Microbiology and Biotechnology, 87(6), pp. 2169-2178.
37. McDermott A. M. (2004), urface
Ocul Surf., 2(4), pp. 229-247.
38. Mookherjee N., Hancock R. E. W. (2007), Cationic host defence peptides: innate immune
regulatory peptides as a novel aCellular and molecular life
sciences, 64(7-8), pp. 922-933.
39. Melo M. N., Ferre R., Castanho M. A. 
activity and high membrane-bound concentrationsNature Reviews, Microbiology, 7, pp.
245-250.
40. Mercado-Pimentel M. E., Jordan N. C.,   ffinity purication of
GST fusion proteins for immunohistochemical studies of gene expression Protein
Expression and Purification, 26, pp. 260-265.
41. 
Journal of Antimicrobial Chemotherapy, 37, pp. 1077-1089.
42. Moore A. J., Devine D. A., Bibby M.     
activity Peptide research, 7(5), pp. 265-269.
43. 
a potent antibacterial protein of Sarcophaga peregrina The Journal of Biological

cecropin X in Escherichia coli International Journal of Molecular Sciences, 8, pp. 478-
491.
54. Structure-antibacterial, antitumor and hemolytic
activity relationships of cecropin A-magainin 2 and cecropin A-melittin hybrid peptides
The journal of peptide research official journal of the American Peptide Society, 53(1), pp.
82-90.
55.  
Nature, 292, pp. 246-
248.
56.         
Nature methods, 8(6), pp. iii-iv.
57. Strominger    Animal Antimicrobial Peptides: Ancient Players in Innate
ImmunityJournal of Immunol, 182, pp. 6633-6634.
58. Suttmann H., Retz M., Paulsen F., Harder J., Zwergel U., Kamradt J., Wullich B., Unteregger
       -family show
BioMed Central Urology, pp. 1-7.
59. 
of DENV-2 nonstructural protein 3 (NS3) and production of the polyclonal antibody for
Dengue Bulletin, 30, pp. 146-156.
60. Ueno S., Kusaka K., Tamada Y., Minaba M., Zhang H., Wang P. C., Kato Y. (2008),
 -terminal proregion of Nematode antimicrobial peptide Cecropin P4 precursor
       Bioscience Biotechnology
Biochemistry, 72(12), pp. 3281-3284.
61. Wachinger M., Kleinschmidt A., Winder D., Pechmann N.V., Ludvigsen A., Neumann M.,

replication of human immunodeficiency virus 1 by suppressi   
Journal of General Virology, 4, pp. 731-740.
62.            
Current Pharmaceutical Design, 9(16), pp. 1277- 1287.
63. BioTeach Journal, 2, pp. 88-

Systems.html
77. />ng-khang-thu-c-khang-sinh-1.292643#y2iCFxHSBTzz
78. />guide/protein-expression/
79.
80. www.who.int/world-health-day/2011/presskit/WHD2011-QA-EN.pdf