A single mismatch in the DNA induces enhanced
aggregation of MutS
Hydrodynamic analyses of the protein-DNA complexes
Nabanita Nag
1
, G. Krishnamoorthy
1
and Basuthkar J. Rao
2
1 Department of Chemical Sciences, Tata Institute of Fundamental Research, Mumbai, India
2 Department of Biological Sciences, Tata Institute of Fundamental Research, Mumbai, India
The DNA mismatch repair (MMR) system, an evolu-
tionarily conserved biochemical pathway, plays an
important role in regulating the genome by correcting
base mismatches arising either from replication errors
(error rate 10
)8
) or from homologous recombination
preventing recombination between DNA molecules
that have high sequence divergence (mismatches) [1–3].
Inactivation of MMR genes results in a significant
increase in the spontaneous mutation rate, thereby
leading to microsatellite repeat instability, where cells
become hyper-recombinogenic, which account for
% 40–50% of hereditary nonpolypopsis colorectal can-
cers in humans [1,4–6].
The most extensively studied adenine methyl directed
MMR pathway of Escherichia coli implicates the parti-
cipation of several gene products, including MutS,
MutL, MutH, DNA helicase II, single-stranded DNA
binding protein, exonuclease I, VII or RecJ exonuclease,

lyses. In the absence of any nucleotide cofactor, free MutS protein [hydro-
dynamic radius (R
h
) of 10–12 nm] shows a small increment in size (R
h
14 nm) following the addition of homoduplex DNA (121 bp), whereas the
same increases to about 18–20 nm with heteroduplex DNA containing a
mismatch. MutS forms large aggregates (R
h
>500 nm) with ATP, but not
in the presence of a poorly hydrolysable analogue of ATP (ATPcS). Addi-
tion of either homo- or heteroduplex DNA attenuates the same, due to
protein recruitment to DNA. However, the same protein ⁄ DNA complexes,
at high concentration of ATP (10 mm), manifest an interesting property
where the presence of a single mismatch provokes a much larger oligomeri-
zation of MutS on DNA (R
h
>500 nm in the presence of MutL) as com-
pared to the normal homoduplex (R
h
% 100–200 nm) and such mismatch
induced MutS aggregation is entirely sustained by the ongoing hydrolysis
of ATP in the reaction. We speculate that the surprising property of a sin-
gle mismatch, in nucleating a massive aggregation of MutS encompassing
the bound DNA might play an important role in mismatch repair system.
Abbreviations
AFM, atomic force microscopy; DLS, dynamic light scattering; MMR, mismatch repair system; R
h
, hydrodynamic radius.
6228 FEBS Journal 272 (2005) 6228–6243 ª 2005 FEBS

goes an ADP to ATP exchange upon binding to mis-
match and forms an ATP hydrolysis independent, but
MutL dependent, sliding clamp along DNA that
encounters downstream MMR components during its
sliding action [9,19]. In the third model MutS remains
at the site of the mismatch following mismatch recog-
nition and interacts with the MutH through space via
MutL mediated crosstalk with MutH, thereby leading
to a loop formation of the intervening DNA [20,21].
Interestingly, additional studies from the proponents
of this model hint at ATP binding in the absence of its
hydrolysis as sufficient to trigger formation of a MutS
sliding clamp [22] of the sort described in the second
model [9,19].
Using nuclease footprinting, gel-shift analyses, and
surface plasmon resonance spectroscopy, it has been
demonstrated that MutS, in an ATP hydrolysis
dependent manner, establishes a near complete cover-
age of mismatch containing DNA, presumably through
a putative ‘treadmilling action’ of protein [23,24].
Essentially this model is a variation of the first one,
where the action of protein translocation on both sides
away from a mismatch, fuelled by the energy of ATP
hydrolysis, obviates the need of looping of intervening
DNA. The in vivo data supporting the MutS–MutL
foci formation suggests the possibility of extensive
recruitment of protein molecules at the sites of mis-
match repair, thereby achieving high enough local con-
centration of protein [25]. Importantly, such models
that implicate high local protein densities rely on the

analyses
In this study, we have investigated the changes associ-
ated with the molecular aggregates of mismatch repair
proteins MutS, MutL in relation to their interaction
with mismatch containing DNA and the ongoing ATP
hydrolysis. Here we have mainly used dynamic light
scattering (DLS) to monitor the hydrodynamic radii
(R
h
) of the molecular complexes as a function of reac-
tion time and corroborated the essential findings by
protein fluorescence and other biochemical assays. The
principal players in the system namely, MutS and
MutL proteins showed a reasonably narrow distribu-
tion of R
h
values with a peak at 10 nm and 4 nm,
N. Nag et al. Hydrodynamic analyses of MutS aggregates
FEBS Journal 272 (2005) 6228–6243 ª 2005 FEBS 6229
respectively (Fig. 1A, Table 1). At the concentration
chosen (0.15 lm), the protein preparation exhibited
hardly any large particulate aggregates. Interestingly,
when the two proteins were mixed at 1 : 1 molar ratio
(0.15 lm each), we observed a distinct shift in the dis-
tribution of R
h
values towards a larger size with a
peak at 25 nm (Fig. 1A, Table 1). Such a shift towards
a size larger than that of the individual proteins is
consistent with the model where the two proteins

should be taken as the upper
limit. If one assumes that MutS exists largely as a
stable dimer, this result suggests that MutS–L com-
plex comprises of a dimer of each, which is entirely
consistent with the data in the literature [20]. This
Fig. 1. Analyses of the R
h
distribution of MutS as a function of its
interaction with MutL. (A) Analyses of the R
h
distribution of MutS
as a function of its interaction with MutL 0.15 l
M MutL (I), 0.15 lM
MutS (II) and a mixture of MutS and MutL (0.15 lM each) (III). The
samples were incubated in buffer A for 10 min at 22 °C, followed
by DLS analyses as specified. (B) MutS.MutL binding isotherm.
Fluorescamine-labelled MutS (0.25 l
M) was taken in buffer C and
titrated with MutL. The steady-state fluorescence measurements
were carried out with the excitation wavelength set at 380 nm
monitoring the change in fluorescence intensity at 477 nm (maxi-
mum k
em
). The smooth line represents the theoretical fit with
dissociation constant of 70 n
M.
Table 1. Hydrodynamic radii (R
h
in nm) of MutS and MutL in the
presence of Homo- or Hetero duplex DNA of different lengths (All

ero) or no mismatch (homo) containing duplex DNA
(0.15 lm of molecules) to MutS protein (0.15 lm)
resulted in interesting changes, where the distribution
of R
h
(of MutS peak at 10 nm) shifted towards a lar-
ger size. The particles in the presence of homoduplex
showed a peak at 14 nm whereas that with hetero-
duplex DNA showed a peak at 20 nm (Table 1). As
the duplex length in homo- vs. heteroduplex is identi-
cal, this result is consistent with the model in which
heteroduplex bound MutS appears to be a larger oligo-
mer than that of the homoduplex bound form (see
Discussion). Interestingly, the larger oligomeric state
of MutS, as reflected by higher R
h
, held true when the
duplex target size was reduced to 61 bp from that of
121 bp, but not so at much shorter duplex size of
16 bp (Table 1). In fact, MutS R
h
values obtained with
16 bp duplex (10 nm) were identical to that of free
MutS itself, thereby suggesting that protein failed to
stably bind the short duplex. The trend of the higher
oligomeric protein form associated with heteroduplex
DNA was observed with the MutS–MutL sample as
well, where addition of homo- and heteroduplex DNA
led to a shift of R
h

h
values of MutS particles. Moreover
the extent of MutS aggregation was clearly ATP con-
centration dependent. At the lowest concentration of
ATP (0.3 mm) tested, the R
h
values increased to % 17–
18 nm from that of 10 nm and the increase ensued
within 2–3 min of ATP addition (Fig. 2A). At the next
higher concentration of ATP (0.6 mm) the rise in R
h
was much more dramatic resulting in 200 nm particles
within the first 2 min and slowly increasing further
beyond 400–500 nm, the limit of detection by DLS, as
a function of time. The width of distribution of R
h
was in the range of % 50 nm in these samples. Next,
two higher concentrations of ATP (1 mm and 10 mm)
brought about rapid aggregation of MutS, generating
particles > 600 nm (Fig. 2A). In fact, it appears that
at these higher ATP concentrations, MutS aggregation
continues to increase even after several minutes of
ATP addition. This experiment demonstrated the ATP
concentration-dependent enhancement in MutS aggre-
gation results in very large (perhaps sedimentable, see
the next portion of the manuscript) particles whose R
h
value exceeded 500–600 nm. We tested whether ADP
also exhibits a similar effect on MutS aggregation by
analysing changes in R

h
changes in MutS were
noted as a function of reaction time. We observed that
the presence of 0.5 mm ATPcS had only a marginal
N. Nag et al. Hydrodynamic analyses of MutS aggregates
FEBS Journal 272 (2005) 6228–6243 ª 2005 FEBS 6231
effect on the changes in R
h
induced by 1 mm ATP
(Fig. 2B) where the R
h
values sharply increased to
more than 400 nm by about 10 min. In contrast when
the concentration of ATPcS that was premixed with
ATP increased to 1 mm, the inhibitory effect on the
increase in R
h
was distinct and dramatic where the
particle size dropped to about 150 nm even after pro-
longed incubation. This experiment suggested that the
presence of ATPcS effectively poisoned the ATP medi-
ated aggregation of MutS. In another protocol we tes-
ted whether the suppression of MutS aggregation by
ATPcS could be reversed by the addition of ATP. As
expected, the control reaction where MutS was incuba-
ted with 1 mm ATPcS alone exhibited no MutS aggre-
gation throughout the incubation period of 30 min
where a particle with an R
h
of 10 nm was observed.

M ATP (h) or 0.5 mM ATPc S+1mM ATP (premixed) (,)
or 1 m
M ATPc S+1mM ATP (premixed) (s)or1mM ATPcS(n),
followed by DLS analyses as a function of incubation time. In a
separate experiment, 1 m
M ATP was added to an ongoing reaction
containing 1 m
M ATPcS at its 15th min of incubation (d), followed
by DLS analyses. (C) Rate of ATP induced aggregation of MutS
depends upon the protein concentration. ATP (1 m
M) was added to
MutS taken at various concentrations [0.05 l
M (,), 0.1 lM (h),
0.15 l
M (n), 0.3 lM (e), 0.45 lM (s)], followed by DLS analyses as
a function of incubation time.
Hydrodynamic analyses of MutS aggregates N. Nag et al.
6232 FEBS Journal 272 (2005) 6228–6243 ª 2005 FEBS
the particles exhibited an R
h
of 100 nm that stayed
constant throughout the time course (Fig. 2C). At the
next highest concentration of MutS (0.1 lm), there was
an increase in the rate of MutS aggregation where the
particles reached an R
h
of 500 nm in about 30 min. It
appears that in this reaction protein aggregation con-
tinued to occur even after 30 min of incubation. In the
other samples where the protein concentrations were

After establishing the basic conditions that influence
MutS aggregation, we studied the same in the presence
of duplex DNA targets that contained or did not
contain a mismatch (heteroduplex or homoduplex,
respectively).
MutS aggregation in the presence of duplex DNA
senses a single mismatched base pair
The role of ATP hydrolysis
MutS–DNA complexes were formed at 1 : 1 ratio,
ATP (1 mm) was added and then R
h
was analysed as
a function of time. As shown earlier (Table 1), before
the addition of ATP we recovered MutS–homoduplex
and MutS–heteroduplex complexes of about 14 and
20 nm in size, respectively. Following ATP addition
there was only a marginal increase in R
h
of both the
complexes where the former reached a size of
24–25 nm and the latter 20–22 nm (Fig. 3A). It is
important to note that MutS had shown extensive
aggregation reaching a particle size of about 500–
600 nm in the same conditions that contained no
duplex DNA (Fig. 2A). In contrast, the current experi-
ment, in which DNA was present, MutS aggregation
was significantly reduced suggesting that the protein
was sequestered on DNA such that free protein aggre-
gation induced by 1 mm ATP was dramatically
reduced. Moreover, reduction in MutS aggregation

2+
essentially reproduced (Fig. 3C) the results
obtained earlier (Fig. 3B), confirming that the effect of
high ATP concentration was genuine where ) specific-
ally ) the presence of a mismatch induced a higher
level of protein aggregation (see Discussion). To test
whether mismatch specific enhanced aggregation of
MutS requires the sustained presence of ongoing ATP
hydrolysis, the following control experiments were car-
ried out. MutS–DNA (hetero ⁄ homo) reactions were
initiated at 10 mm ATP, followed by poisoning of
ATP hydrolysis by either EDTA or ATPcS (10 mm)at
early (3 min) or late (20 min) time-points of DLS-
time-course and analysing further the changes in R
h
.
We surmised that effective poisoning of ongoing ATP
hydrolysis by EDTA or ATPcS might unravel its role
in the maintenance of mismatch induced MutS aggre-
gation, if any. The R
h
analyses as a function of time
revealed that addition of EDTA or ATPcS had signifi-
cantly lowered MutS aggregation specifically in a mis-
match containing reaction. The specificity of such an
effect was evident when the relative change in R
h
(het-
ero minus homo) was plotted as a fraction of maxi-
mum difference observed in R

The role of MutL
We tested further whether such high ATP induced mis-
match specific aggregation of MutS ensues even in the
Fig. 3. ATP induced aggregation of MutS in presence of hetero ⁄ homo- duplex DNA. MutS-DNA complexes were formed by incubating
0.15 l
M of MutS with either heteroduplex (n) or homoduplex (s) DNA (0.15 lM each) for 10 min at 22 °C in buffer containing 50 mM Hepes
pH 7.5, 50 m
M KCl, 5 mM MgCl
2
, followed by adding ATP at various final concentrations [1 mM (A), 10 mM (B)] and analysing the complexes
by DLS as a function of incubation time. High Mg
2+
control of the same was done by forming MutS-DNA complexes with 0.15 lM of MutS
and eitherheteroduplex (n ) or homoduplex (s) DNA (0.15 l
M each) for 10 min at 22 °C in buffer containing 50 mM Hepes pH 7.5, 50 mM
KCl, 15 mM MgCl
2
, followed by adding 10 mM ATP (C) and analysing the complexes by DLS as a function of incubation time. (D) MutS-DNA
complexes (homo- or heteroduplex containing) were formed as described (Fig. 3B) to which either ATPcS or EDTA (10 m
M each) was added
at the third or 20th minute of the reaction time-course (arrows), followed by R
h
measurement as a function of incubation time. The R
h
differ-
ences between hetero and homoduplex-containing reactions reached a maximum at the 40th min with respect to which those at other time-
points [(nR
h
at x
th

ilar to that of minus MutL set (Fig. 3A). The same
experiment in the presence of MutL at high ATP
(10 mm) revealed a dramatic enhancement in the
aggregation of protein that was highly specific to the
presence of a mismatch. The reaction containing
homoduplex DNA exhibited a slow rise in R
h
reaching
a limit of < 200 nm, whereas that of heteroduplex
DNA revealed rapid growth in protein aggregation
that appeared to go beyond an R
h
value of 500 nm
within 15 min (Fig. 4B). Again, the effect was clearly
not due to Mg
2+
limiting (5 mm) conditions, as a
repeat experiment at high Mg
2+
(15 mm) resulted in
the same effect (Fig. 4C), where a single mismatch pro-
voked higher aggregation of MutS in the presence of
high ATP. These experiments suggested a surprising
property of MutS where large protein aggregates form
in a mismatch specific manner, selectively under high
ATP (10 mm) conditions. It should be stressed that the
observation of particles with such large R
h
values and
the dramatic discrimination in the size of complexes in

M ATP (C) and analysing the complexes by
DLS as a function of incubation time.
N. Nag et al. Hydrodynamic analyses of MutS aggregates
FEBS Journal 272 (2005) 6228–6243 ª 2005 FEBS 6235
level of MutS aggregation was lost when we substi-
tuted high ATP with high ADP (10 mm) (data not
shown). In fact at high ADP, the changes in R
h
as a
function of time in homo- vs. heteroduplex DNA
reached about 100 nm, with essentially no difference
between the two sets, again reiterating the specific role
of ATP and its hydrolysis in MutS aggregations (see
Discussion).
We tested the effect of salt (150 mm KCl) on the
formation as well as stability of mismatch induced
MutS aggregation. Normal MutS–DNA reaction con-
tains 50 mm KCl (see Experimental procedures) to
which an additional 100 mm KCl was added either at
the start or at the 20-min time-point of the reaction.
Interestingly, addition of salt at the start of the reac-
tion essentially abrogated mismatch induced dis-
crimination of MutS aggregation, where hetero- as
well as homoduplex reactions showed similar level
of increase in R
h
as a function of time (data not
shown). On the other hand, the same level of salt
added following mismatch induced aggregate forma-
tion (at 20 min) had barely any effect: Higher R

analyses followed by computation of attendant volume
changes in MutS particles as a function of ATP
concentration and DNA length is a separate study that
is currently underway.
Mismatch-dependent MutS aggregation as
revealed by centrifugation assays
In the following sedimentation assays, we monitored
MutS aggregation states in a variety of conditions, des-
cribed earlier, and tried to establish the general validity
of DLS results. MutS protein incubated with increas-
ing concentrations of either ATP or ATPcS was centri-
fuged followed by assaying the protein concentrations
in the supernatant as well as the pellet. In the set con-
taining ATPcS, the entire protein sample was recov-
ered in the supernatant (Fig. 5A) and no protein was
detected in the pellet fractions (data not shown). In
the same conditions the ATP set exhibited nucleotide
cofactor concentration dependent aggregation of MutS
where at about 3 mm ATP a significant fraction of
MutS was recovered in the pellet fraction with a
A
1.2
1.0
0.8
0.6
0.4
0.2
0.0
02468
10 12

experiment demonstrated that MutS aggregation is
highly ATP concentration dependent and corroborated
the DLS results described earlier in this study
(Fig. 2A). In order to verify whether ATP induced
MutS aggregation encompasses the bound DNA in the
complexes, we repeated the centrifugation assay on
MutS-labelled DNA duplex samples. In this experi-
ment, we included MutL along with MutS (0.4 lm
each) and incubated with an equimolar concentration
of 5¢-
32
P-labelled 121-mer hetero ⁄ homoduplex DNA at
increasing concentrations of ATP, followed by a cen-
trifugation assay. The pellet samples recovered in this
assay were treated with EDTA-SDS followed by analy-
sis in a native gel and the recovered labelled DNA was
imaged on a PhosphorImager. The result showed that
hetero and homoduplex DNA was rendered sedimenta-
ble by MutS aggregation in an ATP dependent
manner. In this assay the samples without or a low
amount of ATP showed hardly any sedimentable
DNA while at a concentration of ATP higher than
A
B
DC
Fig. 6. Effect of ATP concentration on aggregation of MutS-MutL-DNA complexes as assessed by centrifugation assay. MutS-MutL-DNA
complexes were formed by incubating of MutS-MutL (preincubated for 5 min by mixing both at 0.4 l
M each) with either heteroduplex or
homoduplex DNA (0.4 l
M each) for 10 min at 25 ° C in buffer A, followed by adding ATP at various final concentrations, incubating for

revealed sedimentable DNA at a concentration of ATP
higher than 5 mm (Fig. 6C,D). Both hetero- and
homoduplex DNA were almost equally sedimentable.
In the same assay one could observe cosedimentation
of both MutS and MutL protein at high ATP. Silver
staining, being more sensitive than Coomassie blue
stainng, revealed some background retention of MutS-
L-DNA on the tubes even in the absence of centrifuga-
tion (lane 1, Fig. 6C,D). Samples containing high ATP
showed a signal for all these three components that
were significantly higher than the background. Taken
together, all of these centrifugation experiments dem-
onstrated high ATP induced aggregation of MutS–
DNA complexes that are highly sedimentable. It is
important to point out that MutS–DNA complexes
obtained with homo- vs. heteroduplex DNA targets
exhibited similar sedimentation properties in the cen-
trifugation assay, although DLS analyses revealed
larger complexes with heteroduplex DNA (Fig. 4B),
suggesting that centrifugation assay fails to discrimin-
ate the size differences associated with MutS–DNA
complexes, but quantitatively scores essentially all
complexes.
Discussion
This study involves the analysis of the changes associ-
ated with MutS aggregation in response to ATP bind-
ing ⁄ hydrolysis and its mismatch recognition in duplex
DNA. The study aims primarily to understand large
aggregational changes associated with MutS to help
model how the protein might transduce the informa-

lar ratio yielded a particle with a significantly higher
R
h
value (25 nm) (Fig. 1A). Indeed the complexation
of MutL with MutS did lead to 1 : 1 stoichiometric
complexes under these conditions, and was established
by an independent experiment involving fluorescence
titration (Fig. 1B). It appears that the MutS–MutL
complex with an R
h
value of 25 nm does reflect a
particle that is somewhat larger than a simple 1 : 1
complex of protein dimers [27,28].
Binding of MutS–MutL to DNA: sensing
of mismatch
Similarly MutS binding to homoduplex DNA led to an
increase in R
h
(DR
h
4 nm) that was smaller than the
increase observed with the heteroduplex DNA of the
same size (DR
h
10 nm) (Table 1). Such an enhanced
increase in the R
h
with heteroduplex DNA is highly
consistent with the conversion of dimeric MutS to that
of tetramer either during or following mismatch recog-

h
of
several hundred nanometers) within less than 5 min
following ATP addition (Fig. 2A). Surprisingly, the
extent of aggregation was highly ATP concentration
dependent in a range far above the micromolar bind-
ing affinity reported for ATP binding with MutS
[29,30], possibly reflecting the role of additional puta-
tive low affinity ATP binding sites in this system.
Expectedly, the ATP mediated protein aggregation was
inhibited by the poisoning action of ATPcS, implying
the role of ATP hydrolysis in MutS aggregation
(Fig. 2B). Moreover, protein aggregation induced by
ADP was significantly lower than that of ATP, reveal-
ing the specificity of the same with ATP. This observa-
tion is highly consistent with earlier report where
gel-filtration analysis revealed that higher order oligo-
merization of MutS was favoured specifically by ATP
hydrolysis [31]. Presence of homo- as well as hetero-
duplex DNA significantly reduced ATP induced aggre-
gation of protein, suggesting the possibility that the
binding of protein to DNA somehow interferes with
the polymerization of free protein (Fig. 3A,B). How-
ever, most intriguingly, protein aggregation reappeared
even in the presence of DNA at a high concentration
of ATP (Fig. 3B). In this high ATP regime, protein
aggregation was not related to limiting Mg
2+
, as the
same was observed even at high concentration of

centration of ADP, where similar R
h
values (100 nm)
were recovered for homo- vs. heteroduplex samples
with MutS. It is surmised that the large MutS aggre-
gates that are mismatch specific in ATP should encom-
pass the mismatch DNA itself as an intrinsic part of
the particle. This indeed is so, was borne out by the
sedimentation analyses of the complexes. Centrifuga-
tion experiments showed that these particles were
highly sedimentable only at high ATP (Fig. 6A,B) and
such sedimenting complexes encompass not only the
protein but also the DNA (Fig. 6C,D). Experiments
performed with ADP (1 mm and 10 m m) revealed a
much lower extent of MutS aggregation where the dis-
crimination rendered by the mismatch was lost, as
revealed by similar R
h
values (100 nm) in homo- vs.
heteroduplex DNA samples. We conjecture that the
propensity of MutS to undergo ATP-induced aggrega-
tion even in the absence of DNA might form the basis
of such massive MutS–MutL-heteroduplex DNA com-
plexes. The hydrodynamic size of such particles con-
taining protein–DNA complexes seem to suggest that
they may in fact represent assemblies that are connec-
ted by intermolecular interactions encompassing sev-
eral rather than single DNA molecules. However, the
techniques used do not allow us to distinguish the
same. In the current study we have uncovered a novel

FEBS Journal 272 (2005) 6228–6243 ª 2005 FEBS 6239
selectively in the presence of a single mismatch and
high ATP. It is highly likely that such an intrinsic
property of MutS to recognize and amplify mismatch
signals could indeed be used by the cells in the context
of MMR. Current models of MMR are rather sketchy:
it is unclear how the signal of a mismatch transduces
to its adjacent hemimethylated GATC tract over a
long distance. The prevailing competing models based
on a large body of biochemical data from E. coli as
well as eukaryotic MutS ⁄ MutL proteins invoke either
ATP-hydrolysis dependent translocation of MutS ⁄
MutL [17,18] or ATP hydrolysis independent passive
sliding clamp of MutS ⁄ MutL [9,19,22] or alternatively,
MutS ⁄ MutL complex stationed at mismatch cross-talk-
ing through space with the GATC tract sites [20,21]. A
variation of the first model proposed by others and us
invokes a near complete coverage of mismatch con-
taining DNA by MutS through a ‘treadmilling action’
of the protein that is highly ATP hydrolysis dependent
[23,24]. The current study, demonstrating a mismatch
specific highly aggregated state of MutS encompassing
bound heteroduplex DNA, is strongly consistent with
this model, where the presence of a mismatch can be
relayed across large distances thereby cross-talking
with GATC-specific excision steps. In addition, the
massively aggregated MutS-heteroduplex complexes
might reflect the propensity of the system that finally
culminate into MutS foci formation at the sites of
DNA mismatch repair in the cells [25]. We conjecture

Tris ⁄ HCl pH 8.0, 1 mm EDTA) by diffusion, followed by
desalting through a Sep-pak C-18 cartridge [36]. Final con-
centration of purified DNA was determined by measuring
the absorbance of an aliquot at 260 nm. The concentrations
expressed pertain to that of molecules.
DNA substrates used in all assays were a single G.T-mis-
matched duplex (121 bp) (Heteroduplex) and its corres-
ponding G.C-matched duplex (Homoduplex), the names
and their corresponding sequences are given in Table 2.
Table 2. Names and lengths of the oligonucleotide sequences used for preparing either heteroduplexs (G.T mismatch at the centre) or the
corresponding homoduplexes (the position of mismatch and the corresponding normal match are highlighted by bold and underline).
Name Size (nt) Sequence
CLL 121 5¢-TCACCATAGGCATCAAGGAATCGCGAATCCGCCTCGTTCCGGCTAAGTAACATGGAGCAG
GTCGCG
ATTTCGACACAATTTATCAGGCGAGCACCAGATTCAGCAATTAAGCTCTAAGCC- 3¢
GTL 121 5¢-GGCTTAGAGCTTAATTGCTGAATCTGGTGCTCGCCTGATAAATTGTGTCGAAATCCGCGA
TCTGCTCC
ATGTTACTTAGCCGGAACGAGGCGGATTCGCGATTCCTTGATGCCTATGGTGA-3¢
GCL 121 5¢-GGCTTAGAGCTTAATTGCTGAATCTGGTGCTCGCCTGATAAATTGTGTCGAAATCCGCGA
CCTGCTCC
ATGTTACTTAGCCGGAACGAGGCGGATTCGCGATTCCTTGATGCCTATGGTGA-3¢
CLE 61 5¢-GCCTCGTTCCGGCTAAGTAACATGGAGCAG
GTCGCGGATTTCGACACAATTTATCAGGCGA-3¢
GTE 61 5¢-TCGCCTGATAAATTGTGTCGAAATCCGCGA
TCTGCTCCATGTTACTTAGCCGGAACGAGGC-3¢
GCE 61 5¢-TCGCCTGATAAATTGTGTCGAAATCCGCGA
CCTGCTCCATGTTACTTAGCCGGAACGAGGC-3¢
CLS 16 5¢-TAGGTACG
GTCCATGC-3¢
GTS 16 5¢-GCATGGA

32
Pat5¢ end was performed as des-
cribed [38]. Complementary strands (see Table 2) were
annealed at a 1 : 1 ratio (10 lm of each strand in a total
volume of 20 lL) in 20 mm Tris ⁄ HCl pH 7.5 and 10 mm
MgCl
2
by heating the sample for 5 min at 90 °C, followed
by slow cooling to room temperature. Analysis of an ali-
quot of annealed sample on native polyacrylamide gel
revealed that the annealed duplex was well resolved from
the single-stranded controls and annealing was achieved
with > 90% of efficiency.
MutS–DNA complex formation
MutS–DNA complexes are formed by adding duplex DNA
(homo- or heteroduplex) to MutS in buffer (50 mm Hepes
pH 7.5, 50 mm KCl, 5 mm MgCl
2
,1mm dithiothreitol),
followed by incubation of the sample for 10 min at room
temperature (% 22 °C). Similarly, MutS–MutL-DNA com-
plexes are formed by adding duplex DNA to a mixture
containing MutS and MutL. In experiments involving
nucleotide cofactors such as ATP or ATPcS, MutS-DNA
(or MutS–MutL-DNA) complexes were first formed, fol-
lowed by the addition of nucleotide cofactors. In experi-
ments involving only MutL, the protein was analysed in the
same buffer. Concentrations and time ⁄ temperature of incu-
bations are as specified.
Fluorescence labelling of MutS with

d
ð1Þ
where F
obs
is fluorescence intensity, F
max
is fluorescence
intensity at the end of the reaction, [MutL
2
]
0
is total con-
centration of MutL dimer (Free and MutS-MutL complex)
present and K
d
is dissociation constant. During the titration
of fluorescamine-labelled MutS with MutL (Fig. 1B), it was
ensured that the observed decrease in fluorescence intensity
is not due to any bleaching effect by minimizing the expo-
sure time and by checking with control samples.
DLS: measurement of hydrodynamic radius
DLS experiments were performed at 22 °C on a DynaPro-
MS800 dynamic light scattering instrument (Protein
Solutions Inc., VA) with an inbuilt Laser at 820 nm, by mon-
itoring the scattered light at 90° with respect to irradiation
direction. Buffer solutions were filtered carefully through
20 nm filters (Whatman Anodisc 13) to remove dust parti-
cles. The particulate matter, if any, in the DNA and protein
samples was removed by centrifugation (13 800 g) in a table-
top Eppendorf Centrifuge at 4 °C for 10 min.

k
sinðh

2Þð4Þ
where g, k and h are the refractive index, wavelength of the
irradiation source and the scattering angle, respectively.
When the system is polydisperse in size, G(s) is given by:
GðsÞ¼1 þ
X
k
j¼1
C
j
expðÀD
j
q
2
sÞð5Þ
where D
j
is the translational diffusion constant of the j
th
species with hydrodynamic radius R
j
h
.C
j
gives the fractional
contribution of the j
th

h
value
could be interpreted as follows: the translational dynamics
of the particle being studied is similar to that of a hard
sphere of radius R
h
.
A typical DLS experiment involves the addition of reac-
tion buffer (50 lL; 50 mm Hepes pH 7.5, 50 mm KCl,
5mm MgCl
2
,1mm dithiothreitol or other buffers as speci-
fied in the respective figure legends)to the quartz cuvette,
followed by ascertaining that the buffer system is free of
particles as reflected by very low R
h
(0.1–0.2 nm) values
associated with it. A small aliquot (1–2 lL) of stock protein
sample (MutS ⁄ MutS–MutL), that is cleared of particles by
prior centrifugation (as described above), is added to the
buffer (the final concentration of protein dimer was
0.15 lm or as specified in the legend), followed by collec-
tion of light scattering autocorrelation curves to obtain dis-
tribution of R
h
. In experiments involving MutS interaction
with DNA, the change in protein R
h
was monitored, in real
time, following the addition of either hetero or homoduplex

8 Su SS, Lahuae RS, Au KG & Modrich P (1988)
Mispair specificity of methyl directed DNA mismatch
correction in vitro. J Biol Chem 263, 6829–6835.
9 Gradia S, Acharya S & Fishel R (1997) The human mis-
match recognition complex hMSH2-hMSH6 functions
as a novel molecular switch. Cell 91, 995–1005.
10 Cooper DL, Lahue RS & Modrich P (1993) Methyl
directed mismatch repair is bidirectional. J Biol Chem
268, 11823–11829.
11 Buermeyer AB, Deschenes SM, Baker SM & Liskay
RM (1999) Mammalian DNA mismatch repair. Annu
Rev Genet 33, 533–564.
12 Yang W (2000) Structure and function of mismatch
repair proteins. Mutat Res 460, 245–256.
13 Hopfner KP & Tainer JA (2000) DNA mismatch repair:
the hands of a genome guardian. Struct Folding Design
8, R237–R241.
14 Lamers MH, Perrakis A, Enzlin JH, Winterwerp HHK,
Wind N & Sixma TK (2000) The crystal structure of
DNA mismatch repair protein MutS binding to G.T
mismatch. Nature 407, 711–717.
Hydrodynamic analyses of MutS aggregates N. Nag et al.
6242 FEBS Journal 272 (2005) 6228–6243 ª 2005 FEBS
15 Obmolova G, Ban C, Hsieh P & Yang W (2000) Crystal
structures of mismatch repair protein MutS and its
complex with a substrate DNA. Nature 407, 703–710.
16 Wang H, Yang Y, Schofield MJ, Du C, Fridman Y,
Lee SD, Larson ED, Drummond JT, Alani E, Hsieh P
& Erie D (2003) DNA bending and unbending by MutS
govern mismatch recognition and specificity. Proc Natl

25 Smith BT, Grossman AD & Walker GC (2001) Visuali-
zation of mismatch repair in bacterial cells. Mol Cell 8,
1197–1206.
26 Bjornson KP, Blackwell LJ, Harvey S, Batinger C,
Allen D & Modrich P (2003) Assembly and molecular
activities of MutS tetramer. J Biol Chem 278, 34667–
34673.
27 Wu H-T & Marinus MG (1999) Deletion mutation ana-
lysis of the mutS gene in Escherichia coli. J Biol Chem
274, 5948–5952.
28 Grilley M, Welsh KM, Su S-S & Modrich P (1989) Iso-
lation an Characterisation of Escherichia coli mutL.
J Biol Chem 264, 1000–1004.
29 Worth L Jr, Bader T, Yang J & Clark S (1998) Role of
MutS ATPase activity in MutS,1-dependent block of in
vitro strand transfer. J Biol Chem 273, 23176–23182.
30 Antony E & Hingorani MM (2003) Mismatch recogni-
tion-coupled stabilisation of Msh2-Msh6 in an ATP-
bound state at the initiation of DNA Repair. Biochemis-
try 42, 7682–7693.
31 Bjornson KP, Allen DJ & Modrich P (2000) Modula-
tion of MutS ATP Hydrolysis by DNA Cofactors.
Biochemistry 39, 3176–3183.
32 Su S-S & Modrich P (1986) Escherichia coli mutS-
encoded protein binds to mismatched DNA base pairs.
Proc Nati Acad Sci USA 83, 5057–5061.
33 Hall MC, Wang H, Erie DA & Kunkel TA (2001) High
affinity cooperative DNA binding by the yeast Mlh1-
Pms1 heterodimer. J Mol Biol 312, 637–647.
34 Bebenek K, Matsuda T, Masutani C, Hanaoka F &