Light regulation of CaS, a novel phosphoprotein in the
thylakoid membrane of Arabidopsis thaliana
Julia P. Vainonen
1
, Yumiko Sakuragi
2
, Simon Stael
1
, Mikko Tikkanen
1
, Yagut Allahverdiyeva
1
,
Virpi Paakkarinen
1
, Eveliina Aro
1
, Marjaana Suorsa
1
, Henrik V. Scheller
2
, Alexander V. Vener
3
and Eva-Mari Aro
1
1 Department of Biology, Plant Physiology and Molecular Biology, University of Turku, Finland
2 Department of Plant Biology, Faculty of Life Sciences, University of Copenhagen, Denmark
3 Department of Clinical and Experimental Medicine, Faculty of Health Sciences, Linko
¨
ping University, Sweden
Protein phosphorylation is one of the key mechanisms

phosphorylation still remains to be elucidated [4,12].
Keywords
high light; protein phosphorylation; STN8
kinase; stress response; thylakoid
membrane
Correspondence
E M. Aro, Department of Biology,
Plant Physiology and Molecular Biology,
University of Turku, FI-20014 Turku, Finland
Fax: +358 2 333 5549
Tel: +358 2 333 5931
E-mail: evaaro@utu.fi
(Received 18 December 2007, revised 7
February 2008, accepted 13 February 2008)
doi:10.1111/j.1742-4658.2008.06335.x
Exposure of Arabidopsis thaliana plants to high levels of light revealed
specific phosphorylation of a 40 kDa protein in photosynthetic thylakoid
membranes. The protein was identified by MS as extracellular calcium-
sensing receptor (CaS), previously reported to be located in the plasma
membrane. By confocal laser scanning microscopy and subcellular fraction-
ation, it was demonstrated that CaS localizes to the chloroplasts and is
enriched in stroma thylakoids. The phosphorylation level of CaS responded
strongly to light intensity. The light-dependent thylakoid protein kinase
STN8 is required for CaS phosphorylation. The phosphorylation site was
mapped to the stroma-exposed Thr380, located in a motif for interaction
with 14-3-3 proteins and proteins with forkhead-associated domains, which
suggests the involvement of CaS in stress responses and signaling path-
ways. The knockout Arabidopsis lines revealed a significant role for CaS in
plant growth and development.
Abbreviations

transitions. The homologous STN8 protein kinase is
involved in the phosphorylation of PSII core proteins
and is absolutely essential for phosphorylation of
PsbH protein of PSII at Thr4 [18,19].
Here we report the identification of a novel phos-
phoprotein, calcium-sensing receptor (CaS), from thy-
lakoid membranes of Arabidopsis. The protein was
previously named CaS and characterized as an extra-
cellular calcium-sensing receptor localized in plasma
membrane [20,21]. Both biochemical and immunolocal-
ization studies, however, provide strong evidence that
CaS is a chloroplast protein localized in the thylakoid
membrane and not detectable in the plasma mem-
brane. It is shown that the CaS protein level as well as
its phosphorylation level increase in response to
increasing light intensities. The phosphorylation site is
mapped to Thr380, and is shown to be dependent on
the STN8 protein kinase. Insertional mutagenesis of
CaS resulted in reduced growth, indicating a significant
role for CaS protein in plant growth and development.
Results
Identification of CaS as a thylakoid 40 kDa
phosphoprotein
In order to investigate the molecular mechanisms
involved in acclimation of plant photosynthetic
machinery to high light intensities, we isolated thyla-
koid membranes from the leaves of Arabidopsis and
analyzed the light-induced changes in protein phos-
phorylation by immunoblotting with phosphothreo-
nine-specific antibody (Fig. 1A). This analysis revealed

collision-induced fragmentation. The parent ion is labeled in the spectrum along with the fragment ion at m ⁄ z 524.8 produced after the char-
acteristic neutral loss of phosphoric acid. The detected b-ions (N-terminal) and y-ions (C-terminal) are indicated in the spectrum as well as in
the corresponding amino acid sequence. The ions marked with an asterisk indicate that the fragments underwent neutral loss of 98 Da
(H
3
PO
4
). The lower-case ‘t’ indicates a phosphorylated Thr residue. (C) Immunoblot with CaS-specific antibody [for experimental settings,
see (A)].
CaS – novel thylakoid phosphoprotein of Arabidopsis J. P. Vainonen et al.
1768 FEBS Journal 275 (2008) 1767–1777 ª 2008 The Authors Journal compilation ª 2008 FEBS
tography (IMAC) [19] for phosphopeptide enrichment.
The enriched phosphopeptides were analyzed by liquid
chromatography (LC)-MS ⁄ MS.
Besides several known phosphopeptides of the thyla-
koid membranes (supplementary Table S1), the analysis
of data allowed the identification of a novel, previously
uncharacterized phosphopeptide. The product ion spec-
trum of the corresponding doubly charged molecular
ion with m ⁄ z 573.8 is presented in Fig. 1B. The series
of b- and y-ions revealed the peptide sequence
SGtKFLPSSD, with lowercase ‘t’ indicating phoshory-
lated Thr. A search in the Arabidopsis protein sequence
database revealed that the amino acid sequence belongs
to the C-terminus of the expressed protein At5g23060
with deduced molecular mass 41.3 kDa, previously
described as an extracellular CaS [20].
In a parallel approach, the gel region corresponding
to the 40 kDa phosphoprotein band in the gel
(Fig. 1A) was cut out and subjected to in-gel digestion

To further dissect the distribution of CaS in the thy-
lakoid membrane, the thylakoids isolated from leaves
exposed to high light were fractionated by digitonin
[6]. Immunoblot analysis of thylakoid fractions
revealed the presence of CaS both in grana and in
stroma thylakoids, and its clear enrichment in the
stroma-exposed membranes (Fig. 2B).
To further investigate the contradiction between our
data and published reports showing the targeting of
fluorescent-labeled CaS to the plasma membrane
[20,21], we fused the yellow fluorescent protein (YFP)
recombinantly to the C-terminus of CaS and tran-
siently expressed this construct in Nicotiana benthami-
ana leaves. Observations by confocal laser scanning
microscopy clearly demonstrated that the CaS–YFP
fusion protein localized in chloroplasts (Fig. 3A–C). In
stark contrast, the cytosolic YFP control accumulated
YFP fluorescence signal in the cell periphery and
nuclei (supplementary Fig. S1). These data clearly
demonstrate that CaS predominantly resides in chlo-
roplasts. Coexpression of CaS–YFP and GWD1tp–
green fluorescent protein (GFP), a chloroplast-targeted
protein used as a marker, showed perfect overlap of
the YFP and GFP signals (Fig. 3D–F), and no signal
was detected in the cell periphery. Coexpression of
CAS–YFP and the cytosolic GFP further illustrated
the exclusive localization of CAS–YFP in chloroplasts
(supplementary Fig. S2).
Requirement of STN8 kinase for CaS
phosphorylation

40 kDa CaS phosphorylation in the stn8 mutant
(Fig. 4A). Analysis of the same fractions with CaS-
specific antibody revealed similar levels of CaS in all
samples. The migration of CaS in SDS ⁄ PAGE of
thylakoid proteins isolated from the stn8 mutant was
slightly faster than those of the wild-type and the stn7
mutant (Fig. 4B), which is typically observed when
protein phosphorylation is altered (see also Fig. 1A).
These data suggest that CaS is almost fully phosphory-
lated under high-light conditions, as the upper band
corresponding to the phosphorylated form dominated
under high-light conditions in the wild-type (Figs 1A
and 4B) and the stn7 mutant (Fig. 4B).
The involvement of STN8 in the phosphorylation of
CaS was further investigated by isolation of phospho-
peptides from the wild-type and the stn7 and stn8
thylakoids, and analyzing them by LC-MS ⁄ MS. The
mapping of phosphopeptides isolated from stn8 thylak-
oids in comparison to the wild-type and stn7 showed the
specific absence of the CaS-originated phosphopeptide
SGtKFLPSSD with m ⁄ z 573.8
2+
from the thylakoids of
only the stn8 mutant. These results revealed that CaS in
stn8 is not phosphorylated at Thr380, and suggest either
that CaS is a direct target of the STN8 protein kinase or
STN8 is a crucial component of the protein phosphory-
lation cascade involved in CaS phosphorylation.
Characterization of the CaS mutant lines
The mutant Arabidopsis lines with T-DNA insertion in

was loaded in each well. (B) one microgram of chlorophyll was
loaded in each well.
CaS – novel thylakoid phosphoprotein of Arabidopsis J. P. Vainonen et al.
1770 FEBS Journal 275 (2008) 1767–1777 ª 2008 The Authors Journal compilation ª 2008 FEBS
that this band represents CaS. To verify the lack of
CaS transcripts in the mutant plants, RT-PCR analysis
of mRNA from the mutant and wild-type plants was
performed (Fig. 5C). The CaS knockout plants showed
retarded growth even under normal unstressed condi-
tions (Fig. 5D), indicating its important role in plant
growth.
To obtain further insights into the mechanisms
responsible for the observed phenotype, we analyzed
the photochemical efficiency of PSII by fluorescence
measurements and the susceptibility of the CaS mutant
to photoinhibition of PSII. However, no difference in
the decrease of the variable fluorescence ⁄ maximal fluo-
rescence (F
v
⁄ F
m
) ratio during high light illumination
(1500 lmol photonÆm
)2
Æs
)1
for 3 h) or during subse-
quent recovery at low light (30 lmol photonÆm
)2
Æs

proteins with the ‘forkhead-associated’ (FHA) domain.
These domains are found in a variety of signaling pro-
teins, and can bind directly to the phosphothreonine
residue [25]. The identified phosphorylation site,
Thr380, of CaS lies within this motif (Fig. 6A).
CaS appears to be a plant-specific protein. It has
homologs in Oryza sativa (gi:41352315) and Medica-
go truncatula (gi:92878521), as well as in the green
algae Chlamydomonas reinhardtii (gi:46093489) and
A
B
C
D
Fig. 5. Phenotype revealed by the CaS knockout plants. Immunoblot analyses of thylakoids isolated from wild-type and CaS knockout plants
using CaS-specific, D1-specific (A) or phosphothreonine-specific (B) antibody. (C) Ethidium bromide-stained gel with RT-PCR products show-
ing no cas transcript in CaS knockout mutant lines and the presence of 18S rRNA in both mutant lines and the wild-type. (D) Retarded
growth revealed by CaS knockout plants 3 weeks (upper panel) and 5 weeks (lower panel) after sowing the seeds.
J. P. Vainonen et al. CaS – novel thylakoid phosphoprotein of Arabidopsis
FEBS Journal 275 (2008) 1767–1777 ª 2008 The Authors Journal compilation ª 2008 FEBS 1771
Ostreococcus tauri (gi:116059237) (Fig. 6B). No pro-
teins with significant sequence similarity to CaS were
found in cyanobacteria. According to hydropathy
analysis (tmhmm at and sosui
at ), CaS in higher
plants has one transmembrane helix (amino acids 188–
210 in Arabidopsis), whereas the green algae proteins
do not contain any transmembrane region. Alignment
of protein sequences with clustalw (Fig. 6B) showed
that phosphorylated Thr380 is conserved in homolo-
gous proteins of green algae.

chloroplast as the primary destination of CaS
(Fig. 3).
A
B
Fig. 6. Domain structure and homologous proteins of CaS. (A) Schematic representation of the domain structure of CaS. Polypeptide mod-
ules are indicated as follows: TP, chloroplast transit peptide; TM, transmembrane region; rhodanese-like, rhodanese homology domain; 14-3-
3, motif for interaction with 14-3-3 proteins; FHA1, motif for interaction with forkhead-associated domain 1. The phosphorylated Thr380 is
indicated by pThr. (B) Alignment of Arabidopsis CaS with the amino acid sequences of putative homologous proteins from higher plants and
green algae. The lowercase ‘t’ above the sequence indicates phosphorylated Thr380. The predicted transmembrane domain is marked by a
dashed line above the sequence.
CaS – novel thylakoid phosphoprotein of Arabidopsis J. P. Vainonen et al.
1772 FEBS Journal 275 (2008) 1767–1777 ª 2008 The Authors Journal compilation ª 2008 FEBS
Further subfractionation of thylakoids isolated from
leaves exposed to high light and probing of these frac-
tions with CaS-specific antibody showed that the
majority of CaS protein is localized to the stromal thy-
lakoids (Fig. 2B).
Evidence for CaS phosphorylation is provided by the
mapping of the exact phoshorylation site, which corre-
sponds to Thr380 in the C-terminus of the protein.
Making use of two chloroplast protein kinase mutants
of STN7 and STN8, it was possible to assign CaS as a
likely substrate of the chloroplast-targeted STN8 pro-
tein kinase (Fig. 4A). As STN8 protein kinase phospho-
rylates stroma-exposed Thr residues of PSII core
proteins [18,19], the C-terminus of CaS is most likely
oriented to the stroma, where it can be involved in signal
propagation from chloroplasts to other cellular com-
partments. STN8 kinase is selective for phosphorylation
of easily accessible residues, such as N-terminal threo-

and responses of plants to environmental cues. The
main location of CaS in stroma-exposed thylakoid
regions is in line with its possible signaling function.
The stroma-exposed C-terminal part of CaS has a
rhodanese-like protein domain (Fig. 6A). This domain,
lacking the catalytic residues in some cases, is found in
a wide variety of functionally distinct proteins in fre-
quent association with other domain structures known
to be involved in signal transduction [30], suggesting
that CaS might play a role in sensing and signaling of
environmental cues. It has been demonstrated that
rhodanese domain proteins are associated with specific
stress conditions, including the process of leaf senes-
cence in Arabidopsis [31].
The C-terminus of CaS contains also a motif for
interaction with 14-3-3 proteins and FHA domains,
according to eukaryotic linear motif prediction at
. 14-3-3 proteins are known to
function as adaptors that mediate protein–protein inter-
actions and to be involved in signal transduction and
stress responses and also in protein import into
chloroplasts [32]. FHA domain proteins are directly
involved in signal transduction, and the interaction
between the FHA domain and target proteins is strictly
dependent on phosphorylation of Thr residues of the
target proteins [25,33]. The identified phosphorylation
site of CaS at Thr380 is located within these predicted
motifs, and its phosphorylation is intricately regulated
by environmental cues. Although direct experimental
evidence for such protein–protein interactions is still

Total RNA of frozen leaf tissues was extracted with TRIzol
(Invitrogen, Carlsbad, CA, USA). After RNase-free DNase
treatment, 1 lg of total RNA was used to synthesize cDNA
using SuperScript III reverse transcriptase (Invitrogen) in a
40 lL reaction volume. Four microliters (1 ⁄ 10) of RT prod-
uct was used for PCR amplification with CaS-specific and
18S RNA control primers. The forward and reverse primers,
respectively, for the 18S RNA were 5¢-CTGCCAGTAGT
CATATGCTTGTC-3¢ and 5¢-GTGTAGCGCGCGTGCG
GCCC-3¢. The forward and reverse primers, respectively,
for CaS were 5¢-AAATGGCAACGAAGTCTTCAC-3¢ and
5¢-CAGTCGGAGCTAGGAAGGAA-3¢.
Isolation of plasma membrane, intact
chloroplasts, stroma and thylakoids
The plasma membrane fraction of Arabidopsis was isolated
as previously described [36]. Intact chloroplasts were iso-
lated from mature Arabidopsis leaves using a two-step Per-
coll gradient [37]. The stroma fraction was obtained after
chloroplast lysis in buffer and centrifugation at 15 000 g.
Thylakoid membranes were isolated as described previously
[38], including protease inhibitor cocktail (Complete;
Roche, Mannheim, Germany). Thylakoids were subfrac-
tionated into grana, margin and stroma lamellae by using
the digitonin method as previously described [6].
SDS ⁄ PAGE and immunoblotting
The proteins were separated by SDS ⁄ PAGE with 6 m urea
and transferred to an Immobilon poly(vinylidene difluoride)
membrane (Millipore, Bedford, MA, USA). The membranes
were blocked with 5% (w ⁄ v) milk or BSA, and incubated
with protein or phosphothreonine-specific antibody (poly-

2
O ⁄ acetonitrile (ACN) ⁄ MeOH (1 : 1 : 1). Phos-
phopeptides were eluted with 4 · 10 lLof20mm Na
2
HPO
4
with 20% ACN, and desalted using POROS R3 (PerSeptive
Biosystems, Framingham, MA, USA).
LC-MS/MS
In-gel trypsin digestion was performed as previously
described [40]. Tandem MS was performed on an API
QSTAR (Applied Biosystems, Foster City, CA, USA)
equipped with a nanoelectrospray source (MDS Protana,
Odense, Denmark) and connected in-line with the nano-
HPLC system (LC Packings, Amsterdam, the Netherlands).
Eluted and dried peptide samples were dissolved in 9 lLof
2% formic acid, centrifuged for 10 min at 12 000 g, and
transferred to an autosampler vial. Aliquots (8 lL) of sam-
ples were loaded onto a C18 PepMap, 5 lm, 1 mm · 300 lm
internal diameter nano-precolumn (LC Packing), desalted
for 1.5 min, and subjected to reverse-phase chromatography
on a C18 PepMap, 3 lm, 15 cm · 75 lm internal diameter
nanoscale LC column (LC Packing). A gradient of 5–50%
ACN in 0.1% formic acid was applied for 50 min with the
flow rate of 0.2 lLÆmin
)1
. The acquisition of MS ⁄ MS data
was performed on-line using the fully automated IDA fea-
ture of the analyst qs software (Applied Biosystems). The
acquisition parameters were 1 s for TOF MS survey scans

Jolla, CA, USA) and the uracil-containing primers nt114
(forward: GGCTTAAUATGGCTATGGCGGAAATGG
CAACGA) and nt115 (reverse: GGTTTAAU
TAAGGATC
CTTAATTAAGCCTCAGCGGGTCGGAGCTAGGAAG
GAACTT), where the underlined sequence was included for
regeneration of a USER cloning cassette. The PCR product
was mixed with the PacI ⁄ Nt.BbvCI-digested plasmid
pCAMBIA330035Su and treated with USER enzyme mix
(New England Biolabs) for 35 min at 37 °C and 25 min at
25 °C. The reaction mix was directly used to transform Esc-
herichia coli DH10B chemically competent cells, the positive
clone, pCAS, was obtained, and the correct insertion was
verified by sequencing. A YFP fragment was amplified by
PCR using the uracil-containing primers nt59 (forward pri-
mer: GGCTTAAUCTGGGTAGCGGTGGAATGGTGAG
CAAGGGCGAGGAG) and nt34 (reverse primer: GGTT
TAAUTTACTTGTACAGCTCGTCCAT). The product
was mixed with the PacI ⁄ Nt.BbvCI-digested pCAS, treated
with USER enzyme mix, and used to transform E. coli
DH10B. The fusion construct, pCASYFP, was verified by
sequencing and was subsequently introduced to Agrobacte-
rium tumefaciens strain C58 pGV3850 for heterologous
expression in tobacco. GWD1tp–GFP consisted of chloro-
plast transit peptide for glucan water dikinase 1 fused to
GFP, and was used as a chloroplast marker.
Transient expression and subcellular localization
in N. benthamiana
Overnight cultures of A. tumefaciens bearing appropriate
plasmid constructs were harvested, resuspended in a buffer

Biotechnology for maintenance of the MS unit.
References
1 Vener AV (2007) Environmentally modulated phosphor-
ylation and dynamics of proteins in photosynthetic
membranes. Biochim Biophys Acta 6, 449–457.
2 Michel H, Griffin PR, Shabanowitz J, Hunt DF & Ben-
nett J (1991) Tandem mass spectrometry identifies sites
of three post-translational modifications of spinach
light-harvesting chlorophyll protein II. Proteolytic
cleavage, acetylation, and phosphorylation. J Biol Chem
266, 17584–17591.
3 Vener AV, Harms A, Sussman MR & Vierstra RD
(2001) Mass spectrometric resolution of reversible pro-
tein phosphorylation in photosynthetic membranes of
Arabidopsis thaliana. J Biol Chem 276, 6959–6966.
4 Hansson M & Vener AV (2003) Identification of three
previously unknown in vivo protein phosphorylation
sites in thylakoid membranes of Arabidopsis thaliana.
Mol Cell Proteomics 2, 550–559.
5 Rintamaki E, Kettunen R & Aro EM (1996) Differen-
tial D1 dephosphorylation in functional and photodam-
aged photosystem II centers. Dephosphorylation is a
prerequisite for degradation of damaged D1. J Biol
Chem 271, 14870–14875.
6 Baena-Gonzalez E, Barbato R & Aro EM (1999) Role
of phosphorylation in the repair cycle and oligomeric
structure of photosystem II. Planta 208, 196–204.
7 Allen JF (1992) Protein phosphorylation in regulation
of photosynthesis. Biochim Biophys Acta 1098, 275–335.
8 Rintamaki E, Martinsuo P, Pursiheimo S & Aro EM

crocolumns and tandem mass spectrometry. J Proteome
Res 5, 973–982.
15 Carlberg I, Hansson M, Kieselbach T, Schroder WP,
Andersson B & Vener AV (2003) A novel plant protein
undergoing light-induced phosphorylation and release
from the photosynthetic thylakoid membranes. Proc
Natl Acad Sci USA 100, 757–762.
16 Turkina MV, Kargul J, Blanco-Rivero A, Villarejo A,
Barber J & Vener AV (2006) Environmentally modu-
lated phosphoproteome of photosynthetic membranes
in the green alga Chlamydomonas reinhardtii. Mol Cell
Proteomics 5, 1412–1425.
17 Bellafiore S, Barneche F, Peltier G & Rochaix JD
(2005) State transitions and light adaptation require
chloroplast thylakoid protein kinase STN7. Nature 433,
892–895.
18 Bonardi V, Pesaresi P, Becker T, Schleiff T, Wagner R,
Pfannschmidt T, Jahns P & Leister D (2005) Photosys-
tem II core phosphorylation and photosynthetic accli-
mation require two different protein kinases. Nature
437, 1179–1182.
19 Vainonen JP, Hansson M & Vener AV (2005) STN8
protein kinase in Arabidopsis thaliana is specific in phos-
phorylation of photosystem II core proteins. J Biol
Chem 280, 33679–33686.
20 Han S, Tang R, Anderson LK, Woerner TE & Pei ZM
(2003) A cell surface receptor mediates extracellular
Ca(2+) sensing in guard cells. Nature 425, 196–200.
21 Tang RH, Han S, Zheng H, Cook CW, Choi CS,
Woerner TE, Jackson RB & Pei ZM (2007) Coupling

28 Piippo M, Allahverdiyeva Y, Paakkarinen V, Suoranta
UM, Battchikova N & Aro EM (2006) Chloroplast-
mediated regulation of nuclear genes in Arabidopsis tha-
liana in the absence of light stress. Physiol Genomics 25,
142–152.
29 Kanervo E, Suorsa M & Aro EM (2007) Assembly of
protein complexes in plastids. In Cell and Molecular
Biology of Plastids (Bock R, ed), pp. 283–313. Springer-
Verlag, Berlin.
30 Bordo D & Bork P (2002) The rhodanese ⁄ Cdc25 phos-
phatase superfamily. Sequence–structure–function rela-
tions. EMBO Rep 3, 741–746.
31 Azumi Y & Watanabe A (1991) Evidence for a senes-
cence-associated gene induced by darkness. Plant Phys-
iol 95, 577–583.
32 Fulgosi H, Soll J, de Faria Maraschin S, Korthout HA,
Wang M & Testerink C (2002) 14-3-3 proteins and
plant development. Plant Mol Biol 50, 1019–1029.
33 Li J, Lee G, Van Doren SR & Walker JC (2000) The
FHA domain mediates phosphoprotein interactions.
J Cell Sci 113, 4143–4149.
34 Alonso JM, Stepanova AN, Leisse TJ, Kim CJ, Chen
H, Shinn P, Stevenson DK, Zimmerman J, Barajas P,
Cheuk R et al. (2003) Genome-wide insertional
mutagenesis of Arabidopsis thaliana. Science 301, 653–
657.
35 Rosso MG, Li Y, Strizhov N, Reiss B, Dekker K &
Weisshaar B (2003) An Arabidopsis thaliana T-DNA
mutagenized population (GABI-Kat) for flanking
sequence tag-based reverse genetics. Plant Mol Biol 53,

gkl635.
Supplementary material
The following supplementary material is available
online:
Fig. S1. Expression of cytosolic YFP in N. benthami-
ana.
Fig. S2. Expression of CaS–YFP and cytosolic GFP in
N. benthamiana.
Fig. S3. Analysis of thylakoid membrane proteins of
the wild-type and CaS knockout plants.
Fig. S4. Photoinhibition and repair of PSII in CaS
mutant and wild-type plants.
Table S1. Phosphopeptides isolated from wild-type
thylakoids and identified by MS.
Table S2. Proteins identified by LC-MS ⁄ MS analysis
in the gel region corresponding to 40 kDa phospho-
proteins.
Table S3. Photosynthetic activity of wild-type and CaS
knockout plants.
This material is available as part of the online article
from
Please note: Blackwell Publishing are not responsible
for the content or functionality of any supplementary
materials supplied by the authors. Any queries (other
than missing material) should be directed to the corre-
sponding author for the article.
J. P. Vainonen et al. CaS – novel thylakoid phosphoprotein of Arabidopsis
FEBS Journal 275 (2008) 1767–1777 ª 2008 The Authors Journal compilation ª 2008 FEBS 1777