Effects of juvenile hormone on 20-hydroxyecdysone-inducible
EcR
,
HR3
,
E75
gene expression in imaginal wing cells of
Plodia
interpunctella
lepidoptera
David Siaussat, Franc¸oise Bozzolan, Isabelle Queguiner, Patrick Porcheron and Ste
´
phane Debernard
Laboratoire de Physiologie Cellulaire des Inverte
´
bre
´
s, Universite
´
Pierre et Marie Curie, Paris, France
The IAL-PID2 cells derived from i maginal wing discs of the
last larval instar of Plodia interpunctella were responsive to
20-hydroxyecdysone (20E). These imaginal cells respond to
20E by proliferative arrest followed by a morphological
differentiation. These 20E-induced late responses were
inhibited in presence o f j uvenile hormone (JH II). F rom
these imaginal wing cells, we have cloned a cDNA s equence
encoding a P. interpunctella ecdysone receptor-B1 isoform
(PIEcR-B1). The amino a cid s equence o f P IEcR-B1 s howed
a high d egree o f identity with EcR-B1 i soforms o f Bo mb yx
mori, Ma nduca sexta and Choristoneura fumiferana.The

Lepidoptera [2]. This type of development depends on
changes in hemolymphatic levels both of the steroid
hormone 20-hydroxyecdysone (20E) and the sesquiterpe-
noid juvenile hormone (JH II).
The c ontemporary advances in insect endocrinology
and tissue culture have led to widespread, even routine
use, of organ cultures and cell lines for the investigation of
hormonal action [3,4]. N evertheless, most in vitro studies
over the ensuing three decades have focused on ecdyster-
oids [5,6] while few experiments have been performed for
JH II. The first effects of 20E have been reported on
lepidopteran and dipteran imaginal discs cultured in vitro
[7–9]. The mesothoraric wing discs of last larval instar of
Plodia interpunctella respond to 20E by an evagination
followed by a morphological differentiation and the
synthesis of tanned cuticle [8] as described for cultured
Drosophila melanogaster discs [9]. These diverse 20E-
induced responses were inhibited in presence of JH II
[10,11]. Therefore, these results suggested that in vitro
JH II could counteract the 20E-induced differentiation of
imaginals discs but the molecular basis of this action
remained largely unknown.
Most 20E-induced responses are mediated by a nuclear
heterodimeric complex ec dysone receptor (EcR)/ultraspira-
cle [12,13] w hich, when a ctivated by 20E, evokes t he
sequential transcription of genes encoding proteins that
ultimately direct the molt [14–16]. These genes were first
characterized in D. melanogaster and identified as tran-
scription factors such a s E75 [17], E74 [18], HR3 [19] and
BRC [20]. In Manduca sexta, some studies have shown

gical transformation o f IAL-PID2 cells. These c ellular
events could be referred to as differentiative changes of
imaginal wing cells.
This 20E-responsive cell line seemed to be a n appropriate
system in which to identify the molecular mechanisms by
which JH I I could influence the 20E-induced differentiation
of imaginal wing cells. We first tested the sensitivity of
IAL-PID2 cells to JH II examining the effects of this
hormone on 20E-induced late responses such as pro lifera-
tive arrest and morphological differentiation. Using a 5¢/3 ¢
RACE/PCR-based strategy, we isolated a cDNA fragment
encoding a putative P. interpunctella ecdysone receptor B 1-
isoform (PIEcR-B1). Next, we s tudied the effects of JH II
on 20E-induced genetic cascade reporting the indu ction
patterns of PIE75-B isoform, PHR3 , PIEcR-B1 mRNAs by
20E in the presence of JH II. Our results brought evidence
that in v itro JH II prevented the 20E-induced differentiation
of imaginal wing cells. This effect could result from a JH II
action on the 20E-ind uced genetic cascade through a
modulation of PIE75-B, PIEcR-B1 and PHR3 expression.
Materials and methods
Cell culture
The IAL-PID2 cell line was established from imaginal wing
discs of final larval instar of P. interpunc tella Hu
¨
bner, the
Indian meal-moth [25]. The cell line kept its sensitivity to
20E. Cells grow as a loosely attached monolayer. We
maintained them at 26 °Cin75-cm
2

)5
M
[27], t herefore the highest concentration used
was 10
)6
M
.
Isolation of RNA and cDNA synthesis
Total RNAs from cells w ere extracted with TRIzol reagent
(Gibco, BRL) and quantified by spectrophotometry at
260 n m. The quality of RNA was checked by electrophor-
esis on a formaldehyde/agarose gel (1%). U sing the first
strand synthesis kit (Roche), 1 lg total RNA was reverse
transcribed into single-stranded cDNA with AMV reverse
transcriptase and Oligo-p(T)
15
as primer. For 5¢-and
3¢-RACE, cDNA was synthesized from 1 lgtotalRNA
at 42 °C for 1.5 h using the SMART RACE cDNA
Amplification kit (Clontech) with 200 U of Superscript II
(GibcoBRL), 5¢-or3¢- CDS-primer and SMART II
oligonucleotide, according to the instructions in the k it.
PCR amplification and cloning
Two degenerate DNA primers (ED1, ER1) were de signed
on the basis of conserved amino acid sequences
(KCQECRL and VEFAKGL) from the DNA and ligand
binding regions of D . melanogaster, Bombyx mori, Tenebrio
molitor, Choristoneura f umiferana and M. sexta ecdysone
receptors (EcRs). PCR was carried out in 100 lL final
volume including 10 m

TM
SK(+) cloning kit following the manufac-
turer’s instructions. After colony isolatio n, DNA m inipreps
were prepared and correct insertion was determined by
restriction e nzyme a nalysis. The DNA clone containing the
proper insert was se quenced by the dideoxy chain termin-
ation method [28] (Genome Express, Grenoble, France).
One 477-bp RT/PCR product w as isolated and s equenced.
Rapid amplification of cDNA 5¢/3¢-terminal ends
(5¢/3¢-RACE)
The 5¢-and3¢-regions of the corresponding cDNA were
obtained by 5¢-and3¢-RACE(SMARTRACEcDNA
amplification kit) following the manufacturer’s instructions.
For 5¢-RACE, we used 2 lLof5¢-RACE-ready cDNA with
a s pecific reverse primer 5¢-Race PIX (5¢-CCTGGC G
GCCTCTGGTGGTGGCGG-3¢) and Universal primer
Mix (UPM, Clontech) as the forward anchor primer.
The 3¢-RACE amplification was carried out with UPM
as the reverse primer and a specific forward primer
3018 D. Siaussat et al. (Eur. J. Biochem. 271) Ó FEBS 2004
3¢-Race PIY (5-¢GCGGGGCTCGTGTGGTACCAG
GACG-3¢). Touchdown PCR was performed using hot
start as follows: after 1 min at 94 °C, five cycles of 30 s
at 94 °C and 5 min at 72 °C, then five cycles of 30 s at
94 °C, 30 s at 70 °Cand3minat72°C, then 25 cycles
of 30 s at 94 °C, 30 s at 68 °C and 5 min at 72 °C, then
7 m in at 72 °C. The PCR products were purified and
cloned as described above. By merging the overlapping
sequences obtained from the 5¢-and3¢-RACE, a 6081-bp
cDNA fragment was generated and n amed PIEcR.

Results
Effects of JH II on 20E-induced late responses
in IAL-PID2 cells
We first tested the sensitivity of cells to JH II by studying the
effects of this hormone on the 20E-induced late responses
such as proliferative arrest and m orphological differenti-
ation of IAL-P ID2 cells.
Proliferative arrest. The I AL-PID2 cells were seeded at
1.5 · 10
6
per flask and cultured under normal growth
conditions for 36 h, in our model this period of time
corresponded to t he population doubling t ime [29,30]. Cells
were then treated with only 20E at 10
)7
M
or in combination
with JH II at various concentrations for 36 h. At the end of
treatment, the c ell density w as evaluated . Fig. 1 indicates
that 20E alone induced a striking decrease of cell p rolifer-
ation. By contrast, in combination with JH II at 10
)6
or
10
)7
M
, cells grew at almost the normal rate. Intermediate
levels of cell proliferation were attained at 5 · 10
)8
,10

treated by 20E alone (Fig. 2 C). At the highest concentra-
tions of JH II (10
)6
,10
)7
M
), the cultures did not show any
cell aggregation, or cell cytoplasmic extensions and the cell
density was slightly lower than in the control cultures
(Fig. 2 D and E). In the presence of JH II alone at 10
)6
M
,
the shape and the distribution of the cells in culture were
similar to t hose of control cultures (Fig. 2B). T hese results
showed that JH II was able to inhibit efficien tly the effects
of 20E both on cell proliferation and morphological changes
of IAL-PID2 cells.
Isolation and characterization of
P. interpunctella
EcR-B1
mRNA
Cloning of a PIEcR cDNA frament. We wondered
whether the inhibitory effect of JH II could imply an action
of this hormone on molecular events which occur very early
in the cellular re sponse t o 20E. Therefore, we examined the
effects o f JH II o n the 20E-induced genetic cascade and
decided to clone a P. interpunc tella ecdysone receptor.
Usinga5¢/3¢-RACE/PCR-based strategy, a 6081-bp cDNA
fragment was gener ated and named PIEcR (Fig. 3). The

M
JH II (B) o r 10
)7
M
20E (C) or 10
)7
M
20E in combination with J H I I at v arious concentrations 1 0
)6
M
(D), 10
)7
M
(E),
5 · 10
)8
M
(F), 10
)8
M
(G) and 10
)9
M
(H). Each panel shows the representative area of three replicates. The bar in A represents 40 lminA,B,C,
D, E, F, G and H.
3020 D. Siaussat et al. (Eur. J. Biochem. 271) Ó FEBS 2004
steroid hormone nuclear receptor superfamily and was
clearly assigned to the EcR subfamily.
EcR exists in different isoforms ) Ec R-A, EcR-B1 an d
EcR-B2 [39]. All three share common DNA- and ligand-

Fig. 3. Nucleotide and deduced amino acid
sequences o f PIEcR. Nucleotide numbers are
givenontheleftandtheaminoacidnumbers
on the r ight. Letters in the r ight margin des-
ignate d omains. The DNA binding domain
(C region) is underlined and the ligand binding
domain (E region) is u nderlined with dashes.
The helix–turn–zipper motif is do uble-un der-
lined a nd two p olyadenylation signals in the
3¢UTR a re designed in bold type. D egen erate
primers(ED1)and(ER1)(showninboldtype)
were used to generate a cDNA fragment of
477 b p by RT/PCR. The PIX and PIY pri-
mers used for t h e 5¢/3¢)RACE are s hown in
italic and b old type. The PIEcR-B1 specific
probe was ge nerate d by PCR wit h the two
primers, CED and CER, shown in italic type.
Ó FEBS 2004 Effects of JH II on 20E-inducible EcR, HR3, E75 genes (Eur. J. Biochem. 271) 3021
PIEcR-B1 was c onstitutively expressed a t low level over
time (data n ot shown). B y contrast, the pattern of PIEcR-
B1 mRNA induction by 20E was characterized by a
biphasic r esponse w ith p eaks at 2 h and 1 8 h (Fig. 5A). To
define the minimal concentration of 20E required for an
induction of PIEcR-B1 mRNA, IAL-PID2 cells were
exposed to various concentrations of 20E for 18 h. As
shown in F ig. 5B, a significant indu ction of PIEcR-B1
mRNA was first observed at 10
)7
M
20E with an increase up

,
PIE75-B
,
PHR3
transcripts by JH II
The Plodia HR3 and E75 transcription factors have been
identified recently as putative ÔactorsÕ of a 20E-induced
genetic cascade leading t o the inhibition of cell proliferation
and long-term morphological changes of I AL-PID2 cells
[23,24,41]. To examine the effects of J H II on this genetic
cascade, IAL-PID2 cells were cultured in Grace’s medium
containing bo th 20E at 10
)7
M
and JH II at 1 0
)7
M
for
different continuous time exposures. The induction patterns
of PIE75-B, PHR3, PIEcR-B1 mRNAs were determined
under these experimental conditions.
We remarked that in presence of JH II alone at 10
)7
M
or
in absence of hormone, PIE75-B and PIEcR-B1 were
constitutively expressed at a low level over time (Fig. 7A
and C) whereas PHR3 mRNA was never detectable
(Fig. 7 B). In the presence of 20E alone, PHR3 mRNA
was d etectable at 2 h, reached a maximum by 8 h a nd then

MsEcR 98 66 91 222
TmEcR 88 66 66 218
DmEcR 94 66 71 220
Fig. 4. Alignment of the amino a cid sequence of A/B region of PIEcR with D. melanogaster EcR-B1 (DmEcR-B1 [12]), B. mori EcR-B1 (BmEcR-B1
[37]), M. sexta EcR-B1 (MsEcR-B1 [35]), C. fumiferana EcR-B1 (CfEcR-B1 [33]), and T. molitor EcR-B1 (TmEcR-B1 [38]). Gaps are in troduced to
optimize alignm ent. Aste risks indicate identical residu es and dots indicate co nservative su bstitutions. Multiple sequence a lignment was performed
using
CLUSTAL
[58].
3022 D. Siaussat et al. (Eur. J. Biochem. 271) Ó FEBS 2004
on the i nitial 20E-induced increase of PIEcR-B1 mRNA
whereas it prevented the second increase (Fig. 7A).
To determine the effectiveness of JH II, we cultured
IAL-PID2 cells with 10
)7
M
20E alone and in combination
with JH II at various concentrations. Based on the times
required for the maximum inductio n of mRNAs, the l evel of
PIE75-B, PHR3 and PIEcR-B1 mRNAs was assessed after
1, 8 and 18 h exposure, respectively. Fig. 8B and C show
that after 1 h a nd 8 h exposure to 20E, the amount of
accumulated PIE75-B and PHR3 mRNAs increased in
parallel with concentration of JH II up to 10
)6
M
. Thus, the
suppressive effect of JH II on the second 20E-induced
increase in PIEcR-B1 mRNA was also concentration-
dependent when assayed after 18 h exposure to 20E

20E for 18 h. Points are means ± SD (n ¼ 5–11).
Fig. 7. Effect of 20E an d J H II on induct ion of PIE 75-B, PHR3 and
PIEcR-B1 mRNA. Fifteen micrograms of total RNAs from IAL-PID2
cells cultured in Grace’s medium with 20E at 10
)7
M
alone or in
combina tio n with 10
)7
M
JH II for various times were analysed by
Northern blots hybridized with PIEcR-B1 (A), PHR3 (B) or PIE75- B
(C) probes. Levels of the m RNAs of PIE 75-B, PHR3 and PIEcR-B1
are shown as percentages of their respective mRNA levels in IAL-
PID2 cells cultured with 10
)7
M
20E for 1 h, 8 h and 18 h. Points are
means ± SD (n ¼ 5–14).
Fig. 5. Induction of PIEcR-B1 mRNA by 20E. Fifteen micrograms of
total R NAs from IAL-PID2 c ells cultured in Grace’s medium with
20E at 10
)7
M
for various times of exposure (A) or with 20E for 18 h at
different c oncentrations (B) were separated on agarose (1%) formal-
dehyde gel, transferred to nylon membrane and hybridized with
PIEcR-B1 probe. A f ragment of the cDNA encoding the RpL8 ribo-
somal protein of P. int erpuntella was used as c on trol probe.
Ó FEBS 2004 Effects of JH II on 20E-inducible EcR, HR3, E75 genes (Eur. J. Biochem. 271) 3023

eversion and differentiation of imaginal discs [9,46]. First,
we tested the sensitivity of IAL-PID2 cel ls to JH II a nd
showed that in combination with 20E, JH II inhibited
significantly the 20E-induced late responses from 10
)8
M
as
already reported in D. melanogaster Kc cells [44]. This
concentration of JH II was close to physiological levels
which were estimated at 4 · 10
)9
to 2 · 10
)7
M
[45].
To examine the effects of JH II on the 20E-induced
genetic cascade, we first cloned a 6081-bp cDNA encoding a
putative P. interpunctella ecdysone receptor named PIEcR.
The deduced amino acid sequence of PIEcR was most
highly similar to those of EcR proteins from other
lepidopterans, M. sexta [34,35], C. fumiferana [33] and
B. mori [36,37]. The highest identity was located in the C
and E domains. The C domain was identical i n length (66
aminoacids)toDmEcR,CfEcR,MsEcR,TmEcR,BmEcR
and has two C ys2–Cys2 type zinc finger motifs that serve as
interfaces in both DNA–protein and p rotein–protein inter-
actions [47]. The E domain is known to be involved i n ligand
binding, transcriptional activation (or repression), nuclear
translocation a nd dimerization [48]. It h as been demonstra-
ted that EcR needs to form a heterodimer with the

MsEcR-B1 at the time of metamorphic switching of
abdominal epidermis.
Some developmental studies have shown that EcR
isoforms are expressed in a tissue- and stage-specific
manner, thus contributing to the spatial and temporal
diversity of the response t o 20E [33,34,37–39,50,51]. Our
study revealed that EcR-B1 seemed to be the single form
associated with 20E-induced morphological changes of
imaginal wing cells of Plodia. Using a probe common to all
EcR isoforms, we succeeded to detect a second 20E-
inducible transcript whose e xpression level was much lower
Fig. 8. Concentration–respons e curves for the effectiveness of JH II.
IAL-PID2 cells cultured in Grace’s medium with 10
)7
M
20E alo ne or
in combination with J H II a t various concentrations and the levels of
expression of PIE75-B, PHR3 and PIEcR-B1 were a ssessed b y N or-
thern blotting after 1, 8 and 18 h exposure, respectively. mRNA levels
of PIE75-B, PHR3 an d PIEcR-B1 are shown as percentages of the ir
respective mRNA levels in IAL-PID2 cells c ultured with 10
)7
M
20E
for 1 , 8 and 18 h. Points a re means ± SD (n ¼ 7–13).
3024 D. Siaussat et al. (Eur. J. Biochem. 271) Ó FEBS 2004
than that of PIEcR-B1 mRNA (data not shown). If this
transcript is the Plodia EcR-A isoform, then Plodia imaginal
discs would be similar t o t hose o f Manduca during the pupal
predifferentiative phase necessary for eversion and cuticle

also modulated the induction level of PIEcR-B1 and PIE75-
B mR NAs. This action of JH II provided an argument
for the existence of a strong correlation between the
20E-induced genetic cascade, c yclins and proliferative arrest.
JH II had no e ffect on th e initial 20E-induced increase in
PIEcR-B1 mRNA whereas it p revented the second increase.
This result was agreement with that obtained on EcR
homologous gene in the M. se xta epidermis. In this tissue,
JH II prevented the 20E-induced metamorphic switching b y
regulating the induction of EcR by 20E [21,22]. On the other
hand, our study demonstrated that JH II increased the level
of PIE75-B without modifying its induction pattern by 20E.
This JH II effect was similar to that reported on the 20E
inducibility of the E75-A isoform in the cultured silk gland
of Galleria mellonella and in M. sexta epidermis [21,22,54].
The JH II effects on 20E-induced PHR3, PIE75-B, PIEcR-
B1 mRNAs were concentration dependent and significant
at 10
)8
M
. This JH II concentration was identical to that
found in the hemolymph at the onset of the fi fth larval molt
of M. sexta [55].
Molecular data f rom Manduca wing discs have demon-
strated that B R-C transcription factor plays a key role for
their differentiation and that its expression is clearly
controlled by JH II [56]. Therefore, in order to complete
our work, some experiments are in progress to characterize
a Plodia BR-C and then t o examine the effects of JH II
on its induction pattern by 20E in our IAL-PID2 imaginal

mRNA seen in response to 10
)7
M
20E in vitro is
probably required for the differentiative cellular c hanges
of lepidopteran wing discs.
Finally, we demonstrated that in vitro JH II was a ble to
prevent the 20E-induced differentiation o f imaginal wing
cells. In addition, for the fi rst time, our study revealed that
JH II also modulates differently the 20E inducibility o f
EcR-B1 and E75-B isoforms in imaginal cells. This JH II
effect on 20E-induced genetic cascade could be associated
with its action in prevention of differentiative program of
imaginal wing discs at the onset of metamorphosis.
References
1. Cohen, S. (1993) Imaginal Discs Development. Cold Spring Harbor
Press, Cold Spring Harbor, N Y. 9, 74 7–841.
2. Oberlander, H. (1985) The imaginal discs. Comp. I nse ct P hys iol.
Biochem. Phar macol. 2, 151–182.
3. Oberlander, H. & Ferkovich, S.M. (1994) Physiological and
developmental capacities of insect cell lines. In Insect Cell
Biotechnology (Maramorosch,K.&McIntosh,A.H.,eds),pp.
129–140. CRC Press, Boca Raton.
4. Lynn,D.E.,Oberlander,H.&Porcheron, P. (19 88) Tissues and
cells in culture. In Microsocopy Anatomy of Invertebrates (Locke, M.,
ed.), 11C, 1 1 19–1141. Wiley-Liss Inc, New Yor k.
5. Oberlander, H. (1983) Imaginal disks. In Endocrinology of Insects.
(Downs, R.G.H and Laufer, H., e ds), pp. 503–507. A lan R. Liss,
New York.
6. Dinan, L., Spindler-Barth, M. & Spindler, K D. (1990) Insect cell

Genet. 8, 132–138.
15. Thummel, C.S. (1995) From embryogenesis to metamorphosis:
The re gulation and function of Drosophila nuclear receptor
superfamily members. Cell. 83, 871–877.
16. Cherbas, P. & Cherbas, L. (1996) Molecular aspects of ecdysteroid
hormone action. In Metamorphosis: Postembryonic Reprogramming
of Gene Exp ression in Amphibian and Insect Cells (Gilbert, L.I.,
Tata, J.R. & Atkinson, B.G ., eds), pp. 175 –221. Aca demy Press,
San Diego.
17. Segraves, W.A. & H ogness, D.S. (1990) The E75 ecdysone -
inducible gene responsible for the 75B early puff in Drosophila
encodes tw o new m embers of the steroid receptor su perf amily.
Genes Dev. 4, 2 04–219.
18. Thummel, C.S., Burtis, K.C. & Hogne ss, D.S. (1990) Sp acial and
temporal patterns of E 74 transcription during Drosophila devel-
opment. Cell 61, 101–111.
19. Koelle, M.R., Se graves, W.A. & Hogness, D.S. (1992 ) D HR3: a
Drosophila ste roid receptor h omolog. Proc. Natl Acad. Sci. USA
89, 6167–6171.
20. Dibello, P.R. , Withers, D. A., Bayer, C.A ., Fristom, J. W. & Guild, G. M.
(1991) The Drosophila Broad-Com plex encodes a f amily of related
proteins containing, zinc fi ng er. Genetics 129 , 385–397.
21. Hiruma,K.,Shinoda,T.,Malone,F.&Riddiforf,L.M.(1999)
Juvenile hormone modulates 20-hydroxyecdysone-inducib le
ecdysone receptor and ultraspiracle gene expression in the tobacco
hornworm, Manduca s exta. Dev. Genes E vol. 209, 1 8–30.
22. Zhou, B., Hiruma, K., J indra, M., Shinoda, T., S e graves, W.A.,
Malone, F. & Riddiford, L.M. (1998) Regulation of the tran-
scription factor E75 by 20-hydroxyecdysone and juvenile hormone
in the e pidermis of the tobacco hornworm, Manduca sexta,during

31. Kozak, M. (1984) Complilation and analysis of sequences
upstream from the translational star t site in eukaryotic mRNAs.
Nucl. A cids. Res. 12 , 857–872.
32. Caverner, D.R. (1987) Comparison of the consensus sequence
flanking translational start sites in Drosophila and v ertebrates.
Nucl. A cids Res. 15 , 1353–1362.
33. Perera, S.C., Ladd, T .R., Dhadi alla, T.S., Krell, P.J., Sohi, S.S.,
Retnakaran, A. & Palli, S.R. (1999) Studies on two ecdysone
receptor isoforms of the spruce budworm, Christoneura fumiferan.
Mol Cell. Endocrinol. 152, 73–84.
34. Jindra, M., Malone, F., H iruma, K. & Ridd iford, L.M. (1996)
Developmental profiles and ecdysteroid regulation of the
mRNAsfortwoecdysonereceptorisoformsintheepidermisand
wings of the tobacco hornworm, Man duca s exta. Dev. Biol. 180,
258–272.
35. Fujiwara, H., Jindra, M., Newitt, R., Palli, S.R., Hiruma, K. &
Riddiford, L.M. (1995) Clon ing of an ecdysone receptor homolog
from Manduca sexta and the developmental p rofi le of its mRNA
in wings. Insect Biochem. Mol. Biol. 25, 845–856.
36. Swevers, L., Drevet, J.R., Lunke, M .D. & Iatrou, K . (1995) The
silkmoth homolog of the Drosophila ecdysone receptor (B1 iso-
form): cloning and analysis of expression during follicular cell
differentiation. Insect Bioc hem. Mol. Biol. 25, 857–866.
37. Kamimura, M., Tomi ta, S. & Fujiwara, H. (19 96) Molecular
cloning of an e cdysone receptor (B1 isoform) homologue from the
silkworm, Bombyx mori, a nd its m RNA expression during wing
disc development. Comp.Biochem.Physiol.113B, 341–347.
38. Mouillet, J.F., Delbecque, J.P., Quennedey, B. & Delachambre,
J. (1997) Cloning of two putative ecdysteroid receptor
isoforms from Tenebrio molitor and their de velopme ntal expres-

48. Truss, M. & Beato, M. (1993) Steroid h ormone receptors: Inter-
action with deoxyribonucleic ac id and transcription factors. Endo. Rev.
14, 459–479.
49. Maksymowych, A.B., Hsu, T.C. & Litwack, G. (1993) A n ovel,
highly conserved structural motif is present in all members of t he
steroid r eceptor superfamily. Receptor 2, 225–240.
50. Robinow, S., Talbot, W.S., Hogness, D.S. & Truman, J.W. (1993)
Programmed ce ll death in t he Drosophila CN S is ecdyson e-regu-
lated and coupled with a specific ecdysone recep tor i soform.
Development 119, 1251–1259.
51. Huet, F., Ruiz, C. & Richards, G. (1995) Sequential gene activation
by ecdysone in Drosophila melanogaster: the hierarchical equiva-
lence of e arly and e arly late genes. Development 121, 1195–1204.
52. Delachamb re, J., Besson, M.T., Quenn edey, A. & Delbecque, J.P.
(1984) In Biosynthesis, Metabolism and Mode of Action of
Invertebrates Hormones (Hoffmann,J.&Porchet,M.,eds),pp.
245–254. Springer -Verlag, Berlin.
53. Fain, M.J. & Stevens, B. (19 82) Alterations in the cell cycle o f
Drosophila imaginal disc cells pr ecede m etamorphosis. Dev. Bio l.
92, 247–258.
54. Jindra, M. & Riddiford, L.M. (1996) Expression of ecdysteroid-
regulated transcripts in the silk gland of the wax moth, Galleria
mellonella. Dev. Genes Evol. 206, 305–314.
55. Baker, F.D., Tsai, L.W., Reuter, C.C. & Schooley, D.A. ( 1987)
In vivo fluctuation of JH II, JH II acid, and ec dysteroid titer, and
JH II esterase activity, during development of fifth stadium
Manduca s exta. Insect Biochem. 17, 989–996.
56. Zhou, B., Hiruma, K., S hinoda, T. & Riddiford, L.M. (1998)
Juvenile hormone prevents ecysteroid-induced expression of
Broad-complex RNA in the epidermis of the tobacco hornworm,