
-1




i hc Khoa hc T nhiên
  ngành: ; 62.42.30.15
, 
 2011

Abstract: --
-
mã hóa protease HIV-
--rình

-
HIV--
     
protease HIV-

Keywords: ; ; HIV; Gen mã hóa protease; 
Nam

Content


1.
-

-1 (protease



, 2003; 





, 2005; 





, 2008)
c t cho thy vic biu hin và thu nhn protease HIV-1 không d dàng do c tính
c t bào, khó tan ca nó. Mt khác, c-1 phân
, Australia 

2
Âu. -
óm HIV-
 .
protease HIV-1 
                  

HIV-

2. Mc tiêu nghiên cu c tài
- Phát hin mt s t bin trong gen mã hóa protease HIV-1  i Vit Nam.

- C-1   
có  HIV/AIDS.

 124 :  - 39
- 16 - 
50 1 trang. 
.  13 107 
3  ). 



7 41 



.

C 
1.1. HIV-

-1 và HIV-2,





1.2. Các nghiê-1
Protease HIV-pol -
               


, 1996; 





,
1997; 





, 2008). Nguyên nhân là do 

. Protease HIV-
 Pro 

4
(





, 1987; Graves , 1988; 







, 2005; 





, 2005; 





, 2008)

cho các phân nhóm khác.
-protease HIV-1

(





, 2003; 







Gen mã hóa protease HIV--1  


     Invitrogen       
polymerase  New England Biolabs (NEB)  , các vector
 Promega, 

Novagene 
protease HIV-1 và protease HIV-1 tái t Anaspec  
protease HIV- 


2.2.1. 
 theo Sambrook và Russel (2001)
 
 sóng 280 nm

5
2.2.4. 





-1 







-
mono Q-sepharose
2.2.10. 


(SDS-PAGE)
2.2.11. -1 










(Western blotting) -1 

2.2.12. 



-1 s




C trong 60

o
C trong 30 giây. 1,5  1 
khuôn cho PCR vòng 2.  


53
o
C.

 -  tính
-1 và 24 

cho protease HIV-1.

6


3, 4: s-
-1

7
protease
HIV-1-1 phân

ase HIV-
tipranavir/r-

HIV-
3.2. -1 trong E. coli
Gen mã hóa protease HIV-1 HQ317454 trên 
 E. coli. 
-1 phân nhóm CRF01_AE.
3.2.1. 







 -
-E. coli 
-HIV-(Debouck
 , 1987; Graves  , 1988; 




protease HIV-1 (hình 3.8             
         -      
-
-1, 
--1 bi
protease HIV--
8
 -

-
thioredoxin (TRX) trong pE
GTVSFNF) protein gag vào
-
 protease HIV-1 -Pro trên gag-
phóng protease HIV-  rình t mi xuôi HIV-F3 cho PCR vì vc
thit k l

A B

9
A B

Trong mc HIV-R3 có trình t ct gii hn ca Xho
HIV-1 vào pET32a và pET43a ti v u C ca protease s c dung hp vi 6xHis
c b ba kt thúc dch mã. Theo thit k này, nu protease dung hp không có hot
tính t ct ti liên kt Phe-Pro; protease tái t hp to ra s có dng TRX-GTVSFNF-
protease-6xHis trên vector pET32a vi KLPT là 31 kDa và NusA-GTVSFNF-protease-6xHis
trên vector pET43a vi KLPT là 67 kDa. Nu protease tái t hp t ct (ti v trí Phe-Pro), thì
c gii phóng ra dng gn vi 6xHis và có KLPT khong 12 kDa. Vic
ging thi khnh enzyme có hot tính.
Sau khi gen mã hóa protease HIV-         
pET32a-Prot) và pET43a (pET43a- 
E. coli 
LB 

E. coli 
Roesel,

-
 và (Taylor
 , 1992; 





, 1996)
E. coli -
                
protease HIV-1.

Hình 3.15A. SDS-n sc ký
qua ct His-bind ca protease HIV-1 biu hin

c có kh t tng hp (làm gi 
enzyme b c ch bi pepstatin A ging -i và b
mt hot tính xúc tác khi x lý nhit  95
o
C trong 5 phút.
- 
protease
HIV-1 còn . u này buc chúng tôi mt
ln na phn vic ci tin h thng biu hi nâng cao hiu sut biu hin và kh
ch protease HIV-1.
-E. coli BL21
(DE3) RIL
 
            -   
  ch protease HIV-  
Ngoài 
--

protease HIV-
-R4 và HIV--R3 
protease HIV-
HIV-R- GAGTCCTCGAGAGCGTAATCTGGAACATCGTATGGGTA
XhoI HA (Hemagglutinin)
AAAATTTAAAGTGCAGCCAATCTG-
HIV-- GAGTCCTCGAGAGCGTAATCTGGAACATCGTATGGGTA
XhoI HA
TCCCTGAAA ATACAGGTTTTC
TEV
AAAATTTAAAGTGCAGCCAATCTG-
       

Hình 3.19. SDS-             
protease HIV-1 trong h thng vector pET32a và pET43a ci tin
mang pET43a-Prot-TEV-HA; mang pET43a-Prot-TEV-
HA; mang pET43a-Prot-HA; mang pET43a-Prot-HA; 5:
 mang pET32a-Prot-TEV-HA; 7: 
mang pET32a-Prot-TEV-HA; mang pET32a-Prot-HA; 
mang pET32a-Prot-HA 3.2.4. Xây dng quy trình tinh sch protease HIV-1
 u loi b bt các protein không mong muc khi hòa tan các protein
trong ta t bào bm C, ta t bào E. coli mang pET32a-Prot-c ra bng m
Tris-HCl 20 mM pH 7,9 có urea 1M và Triton X-100 1% m B) tinh sch hoàn toàn
protease HIV- dng ci anion mnh mono Q-sepharose mc ni tip
vi ct ái lc His-bind m C n protein không
gn vi gel mono Q-c cho ngay lên ct His-bind; các protein gn vi gel
A B

13
A B
mono Q-c ra chit bm C vi gradient n NaCl 100- 1000 mM; các

cho mt vi KLPT khong 13 kDa trên SDS-c
nhn ra bi kháng th -1 (hình 3.23B). Kt qu phân tích khi
ph MALDI-TOF-TOF (dn liu không nêu  mt ln na khnh protein 13 kDa tinh
sch -1.
Protein HIV-m
C 
n hành  ch phm protease HIV-1 tái t hp sau hm
mn di có SDS và -mercaptoethanol (-m không có SDS và -
n di m có SDS. Kt qu c  hình 3.24 cho
thc  m có SDS và -ME ch phm protease HIV-c ch cho mt
t 13 kDa u kim  không có SDS và -ME thì ch phm
     3 kDa và m    u này chng t s tn ti dng
homodimer trong ch phc. S có mu  không có SDS và
-ME có th m ch n di cha SDS nên mt phn d 
thành t dng dimer, ngoài ra, có th c hch) ca chúng tôi
 làm cho tt c dng monomer chuyn thành dng dimer. Protease HIV-c

14
B
A
hc kim tra hot tính thy phân 
3.25 nh protease HIV-
Tóm lng thành công quy trình tinh sch hoàn toàn protease HIV-1
gn: i) ra ta t m Tris-HCl 20 mM, pH 7,9 có NaCl 100 mM,
urea 1M và Triton X-100 1%; ii) sc ký qua ct mono Q-sepharose và ct His-bind mc ni
tip, ra chit enzyme bám trên ct His-bind bm có cha imidazol 250 mM. Vi quy
trình này ch cn mc hi tính protease HIV-1 nên tit kim thi gian và không làm mt
protease HIV-1 qua các khâu trung gian.
Kt qu tính toán ca chúng tôi cho thy t 100 ml dch nuôi cy t bào E. coli
BL21 (DE3) RIL mang pET32a-Prot-c 1,38 g sinh khi t bào, 23

Hình 3.25.   c  t tng hp ca
protease HIV-1 tái t h   ch. ():
Protease HIV-1 tái t hp, (): Protease HIV-1 tái
t hp + pepstatin A, (): Protease HIV  1 tái t
h lý nhit.
3.3. Nghiên cu mt s tính cht ca Protease HIV-1 tái t hp
3.3.1. Nhi t

 bn nhit ca protease HIV-1 B
A

15
Hình 3.26. 


-
Kt qu nh ho protease HIV-1 tái t hp ti các pH khác nhau (hình 3.26A)
cho thy enzyme hong ti thích ti nhi t 35-37
o
C và không th hin hot tính 
20

, V
max
và K
cat
-
Phi hp k

 -p (hình 3.28) 
p aver-
protease HIV-p có K
m
là 61,3 µM, V
max
là 0,0275 µM/s và K
cat
là 2,86s
-1
.

16

Hình 3.28
protease HIV-


4
 protease HIV-
 (





,
1989)
 , 2007); curcumin (





, 2005), -mangostin,
-mangostin (





, 1996), catechin và epicatechin (





, 2007) 

, 2008). Ngoài ra, mangostin, catechin 
,  , , 
 (





, 2008; Lambert , 2003).

17
a chúng tôi (hình 3.29rotease HIV-

50

Pepstatin A, axit asiatic, curcumin, catechin, epicatechin, -mangostin, -mangostin, 8-
-
50

0,4 µM; 18,9 µM; 48,32 µM; 510 µM; 960 µM; 16,82 µM; 16,25 µM; 104 µM; 114,26 µM.
         


4
     
protease HIV-1 2 


  Zn
2+

 D

D

K 
1. -1 (297 bp)


H69K, V82I, L89M, I13V, I15V, N83T). 

2. -1 E. coli BL21 (DE3)
thioredoxin và 7 axit amin
-hemagglutinin 
 -
-HCl 20 mM pH 7,9 có NaCl 100 mM, urea 1M và Triton X-100 1%;
mono Q--
His-
3. Protease HIV-
m
= 61,3
µM, V
max
= 0,0275 µM/giây, K
cat
= 2,86 s
-1

o


o
C t
--
ng là 18,9 µM, 104

5. Abecasisa A.B., Deforchea K., Snoecka J., Bachelerb L.T., McKennac P., Carvalhod
A.P., Gomesd P., Camachod R.J. and Vandammea A.M. (2005), "Protease mutation
M89I/V is linked to therapy failure in patients infected with the HIV-1 non-B subtypes C,
F or G", AIDS 19, pp. 1799-1806.
6. Aggarwal B.B., Shishodia S. (2004), "Suppression of the nuclear factor-kappaB activation
pathway by spice-derived phytochemicals: reasoning for seasoning", Ann. N. Y. Acad. Sci.
1030, pp. 434441.
7. Akao Y., Nakagawa Y., Iinuma M., Nozawa Y. (2008), "Anti-cancer effects of xanthones
from pericarps of mangosteen", Int. J. Mol. Sci. 9, pp. 355-370.
8. Alastair J.J., Wood M.D., (1998), "HIV-Protease inhibitors", N. Engl. J. Med. 338, pp.
1281-1292.
9. Anson B.D., Weaver J.G., Ackerman M.J., Akinsete O., Henry K., January C.T., Badley
A.D. (2005), "Blockade of HERG channels by HIV protease inhibitors", Lancet 365, pp.
682-686.
10. Ariyoshi K., Matsuda M., Miura H., Tateishi S., Yamada K., Sugiura W. (2003), "Patterns
of point mutations associated with antiretroviral drug treatment failure in CRF01_AE
(subtype E) infection differ from subtype B infection", JAIDS 33, pp. 336-342.
11. Bandaranayake R.M., Jeyabalan M.P, Kakizawa J., Sugiura W., and Schiffer C.A. (2008),
"Structural analysis of HIV-1 CRF01_AE protease in complex with the substrate p1-p6 ",
J. Virol. 82, pp. 6762-6766.

21
12. Baum E.Z., Bebernitz G.A. and Gluzman Y. (1990), "Isolation of mutants of human
immunodeficiency virus protease based on the toxicity of the enzyme in Escherichia coli",
Proc. Natl. Acad. Sci. U. S. A. 87, pp. 5573-5577.
13. Bradford M.M. (1976), "A dye binding assay for protein", Anal. Biochem. 72, pp. 248-
254.
14. Brik A., Wong C.H. (2003). "HIV-1 protease: mechanism and drug discovery", Org.
Biomol. Chem. 1, pp. 5 - 1 4.
15. Ceccherini-Silberstein F., Erba F., Gago F., Bertoli A., Forbici F., Bellocchi M.C., Gori

   n Escherichia coli exhibit
Proc. Natl. Acad. Sci. U. S.
A. 84, pp. 8903-8906.
25. Dergousova N., Amerik A.U., Volynskaya A.M. and Rumsh L.D. (1996), "HIV-I protease
cloning, expression, and purification", Appl. Microbiol. Biotechnol. 61, pp. 97-107.
26. Feinberg M.B. (1996), "Changing the natural history of HIV disease" Lancet 348, pp.
239-246.
27. Field J., Broek D., MacDonald B., Rodgers L., Wilson I.A., Lerner R.A. and Wigler M.
(1988), "Purification of a RAS-responsive adenylyl cyclase complex from
Saccharomyces cerevisiae by use of an epitope addition method", Mol Cell. Biol. 8, pp.
2159-2165.
28. Galli M., Ridolfo A.L., Adorni F., Gervasoni C., Ravasio L., Corsico L., Gianelli E.,
Piazza M., Vaccarezza M., d'Arminio Monforte A., Moroni M. (2002), "Body habitus
changes and metabolic alterations in protease inhibitor-naive HIV-1-infected patients
treated with two nucleoside reverse transcriptase inhibitors", JAIDS 29, pp. 21-31.
29. Gong Y.F., Robinson B.S., Rose R.E., Deminie C., Spicer T.P., Stock D., Colonno R.J.,
Lin P.F. (2000), "In vitro resistance profile of the human immunodeficiency virus type 1
protease inhibitor BMS-232632", Antimicrob. Agents. Chemother. 44, pp. 2319 2326.
30. Graves M.C., Lim J.J., Hei    -kDa form of human
immunodeficiency virus protease expressed in Escherichia coli is sufficient for enzymatic
Proc. Natl. Acad. Sci. U. S. A. 85, pp. 2449-2453.
31. Greene W.C. (2007), "A history of AIDS: looking back to see ahead", Eur. J. Immunol.
37, pp. 94-102.
32. Guo J.S., Cheng C.L., Koo M.W. (2004 ), "Inhibitory effects of Centella asiatica water
extract and asiaticoside on inducible nitric oxide synthase during gastric ulcer healing in
rats", Planta Med. 70, pp. 1150-1154.
33. Hare B.C., (2006), "Clinical Overview of HIV Disease", HIV Insite Knowledge Base
Chapter- www.hivinsite.ucsf.edu.

23

M. (2010), "Sustained appearance of drug resistanceassociated mutations in HIV-1
CRF01_AE protease and reverse transcriptase derived from protease inhibitor-naive Thai
patients", J. Trop. Med. 41, pp. 347-357.

24
44. Kantor R., Katzenstein D.A., Efron B., Carvalho A.P., Wynhoven B., Cane P., Clarke J.,
Sirivichayakul S., Soares M.A., Snoeck J., Pillay C., Rudich H. et all. (2005), "Impact of
HIV-1 subtype and antiretroviral therapy on protease and reverse transcriptase genotype:
results of a global collaboration", PloS. Med. 2, pp. 0325-0337.
45. Kato K., Kusagawa S., Motomura K., Yang R., Shiino T., Nohtomi K., Sato H.,
Shibamura K., Nguyen T.H., Pham K.C., Pham H.T., Duong C.T., Nguyen C.Q., Bui
D.T., Hoang T.L., Nagal Y. and Takebe Y. (2001), "Closely related HIV-1 CRF01_AE
variant among injecting drug users in northern Vietnam: evidence of HIV spread across
the VietnamChina border". AIDS. Res. Hum. Retroviruses 17, pp. 113123.
46. Kemp D.J., Isaacson J.D., King M.S., Brun S.C., Sylte J., Richards B., Bernstein B., Rode
R., Sun E. (2002), "Pharmacokinetic enhancement of inhibitors of the HIV protease by
coadministration with Ritonavir", Antivir. Ther. 7, pp. 165-174.
47. King N.M., Melnick L., Prabu-Jeyabalan M., Nalivaika E.A., Yang S.S., Gao Y., Nie X.,
Zepp C., Heefner D.L. and Schiffer C.A. (2000), "Lack of synergy for inhibitors targeting
a multi-drug-resistant HIV-1 protease", Protein Sci. 44, pp. 2319-2326.
48. Komai T., Ishikawa Y., Yagi R., Suzuki-Sunagawa H., Nishigaki T., Handa H. (1997),
"Development of HIV-1 protease expression methods using the T7 phage promoter
system", Appl. Microbiol. Biotechnol. 47, pp. 241-245.
49. Kräusslich H.G., Ingraham R.H., Skoog M.T., Wimmer E., Pallai P.V. and Carter C.A.
(1989), "Activity of purified biosynthetic proteinase of human immunodeficiency virus on
natural substrates and synthetic peptides", Proc. Natl. Acad. Sci. U. S. A. 86, pp. 807-811.
50. Laemmli U.K. (1970), "Cleavage of structural proteins during the assembly of the head of
bacteriophage T4", Nature 227, pp. 680-685.
51. Lambert J.D., Yang C.S. (2003), "Mechanisms of cancer prevention by tea constituents",
J. Nutr. 133, pp. 3262S-3267S.

Robb M.L. (1999), "Development of calibrated viral load standards for group M subtypes
of human immunodeficiency virus type 1 and performance of an improved amplicor HIV-
1 monitor test with isolates of diverse subtypes", J. Clin. Microbiol. 37, pp. 2557-2563.
61. Mildner A.M., Rothrock D.J., Leone J.W., Bannow C.A., Lull J.M., Reardon I.M.,
Sarcich J.L., Howe W.J., Tomich C.C., Smith C.W., Heinrickson R.L. & Tomasselli A.G.
The HIV-1 protease as enzyme and substrate: mutagenesis of autolysis sites and
generation of a stable of mutant with retained kinetic properties”, Biochemistry 73, pp.
1391-1396.
62. Nakatani K., Yamakuni T., Kondo N., Arakawa T., Oosawa K., Shimura S., Inoue H.,
Ohizumi Y. (2004), "Gamma-mangostin xanthone acts as anti-inflammatory", Mol.
Pharmacol. 66, pp. 667-674.
63. Nashed N.T., Louis J.M., Sayer J.M., Wondrak E.M., Mora P.T., Oroszlan S., Jerina
         -1
Biochem. Biophys. Res. Commun. 163, pp. 1079-1085.